Busch Lab

ZMP

dot1l

Ensembl ID:
ENSDARG00000061992
ZFIN ID:
ZDB-GENE-060503-341
Description:
Novel protein similar to vertebrate DOT1-like, histone H3 methyltransferase (S. cerevisiae) (DOT1L)
Human Orthologue:
DOT1L
Human Description:
DOT1-like, histone H3 methyltransferase (S. cerevisiae) [Source:HGNC Symbol;Acc:24948]
Mouse Orthologue:
Dot1l
Mouse Description:
DOT1-like, histone H3 methyltransferase (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2143886]

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa37502 Essential Splice Site Available for shipment Available now
sa1413 Nonsense Available for shipment Available now
sa39369 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa17639 Nonsense Available for shipment Available now
sa43826 Nonsense Mutation detected in F1 DNA Not yet available
sa17278 Essential Splice Site Available for shipment Available now
sa44985 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa43825 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa37502
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089076 Essential Splice Site 42 1523 2 28
ENSDART00000142046 Essential Splice Site 51 1122 2 27
Genomic Location (Zv9):
Chromosome 22 (position 21136744)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20791420
GRCz11 22 20816398
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCAGGATAAACATCATGATGCTGCACACGAAATCATCGAAACCATTCGG[T/C]GAGTCCATTACCTGTTTTGATTTGATATTATTATTATTATTATTATTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1413
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089076 Nonsense 180 1523 6 28
ENSDART00000142046 Nonsense 189 1122 6 27
Genomic Location (Zv9):
Chromosome 22 (position 21133124)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20787800
GRCz11 22 20812778
KASP Assay ID:
554-1334.1 (used for ordering genotyping assays)
KASP Sequence:
TTGCAGGGGTCGGTCAGGTGGTCCTGCAAGTTGCTGCGGCCACCAATTGT[A/T]AACACTACTATGGCGTGGAGAAAGCAGACATTCCAGCTACCTATGCAGAA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa39369
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089076 Essential Splice Site 263 1523 9 28
ENSDART00000142046 Essential Splice Site 272 1122 9 27
Genomic Location (Zv9):
Chromosome 22 (position 21132592)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20787268
GRCz11 22 20812246
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTGAGGTGGACCACCAGTTGAAGGAACGATTCGCCAACATGAAGGAAGG[T/C]TCGTGGAGTTGAATTTGATATTACAGTATGGATGCACACTAGTTTTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17639
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089076 Nonsense 338 1523 13 28
ENSDART00000142046 Nonsense 347 1122 13 27
Genomic Location (Zv9):
Chromosome 22 (position 21129133)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20783809
GRCz11 22 20808787
KASP Assay ID:
2261-6783.1 (used for ordering genotyping assays)
KASP Sequence:
CTAWTTCTCTTCCCACAACAYATGCGGTGTGTTTTTGGTTCCAGGAGGAA[C/T]AGGAGGTTGCCAGAAGGCGCCCACAGAAGGACAGTAAAGAGAACAAGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43826
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089076 Nonsense 636 1523 20 28
ENSDART00000142046 Nonsense 644 1122 20 27
Genomic Location (Zv9):
Chromosome 22 (position 21118042)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20772718
GRCz11 22 20797696
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCACTGAATCATTGGCTCCCCCTGCTGTTTGTTTCCAGATCAGTATAGTT[G/T]AACTCGAGAAGAGCCAGCGACAGCAGGAGCTCCTTCAGCTCAAGTCATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17278
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089076 Essential Splice Site 782 1523 20 28
ENSDART00000142046 Essential Splice Site 790 1122 20 27
Genomic Location (Zv9):
Chromosome 22 (position 21117601)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20772277
GRCz11 22 20797255
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACCAGGATTCAGCCGCAAACCAGTTYCGGGCACTCGGAAACAWCCATCGG[T/G]GAGTGAAAGTTAGCCAATTAGTTSAGTAAGTACTTATCTATTGGTCACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44985
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089076 Essential Splice Site 889 1523 23 28
ENSDART00000142046 None None 1122 None 27
Genomic Location (Zv9):
Chromosome 22 (position 21114666)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20769342
GRCz11 22 20794320
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAATCCAGCAGGACAGAGCAATGGCAAGCCACCTCTCACGCCTACCTCAG[G/A]TACAGGTCTGCCTTGTTTTTTTTATTTTATTTTTTTTATGCGAAGCCTAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19293
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089076 Essential Splice Site 890 1523 23 28
ENSDART00000142046 None None 1122 None 27
Genomic Location (Zv9):
Chromosome 22 (position 21114665)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20769341
GRCz11 22 20794319
KASP Assay ID:
2261-6781.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATCCAGCAGGACAGAGCAATGGCAAGCCACCTCTCACGCCTACCTCAGG[T/C]ACAGGTCTGCCTTGTTTTTTTTATTTTATTTTTTTTATGCGAAGCCTAGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4169
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089076 Nonsense 1151 1523 26 28
ENSDART00000142046 Nonsense 1102 1122 26 27
Genomic Location (Zv9):
Chromosome 22 (position 21109599)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20764275
GRCz11 22 20789253
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTTGGTGTGACCTGGCATCAAATCTATTGTTTTCTCCTTCAGAATTGAA[C/T]GAAAAATTGCTACTATTTCCTTAGACCGAGATGGACCAGTTAGAGACTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43825
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089076 Nonsense 1278 1523 27 28
ENSDART00000142046 None None 1122 None 27
Genomic Location (Zv9):
Chromosome 22 (position 21109126)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20763802
GRCz11 22 20788780
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCGGTAAACACGTCAGAGCGTTCGCTGCAGAAACAGAAAGTGCGGGAGT[G/A]GGACCTGAAATCTGTAAGTGGATTGGCCAGTCAAAACCTATTTATATCTG
Associated Phenotype:
Not determined