Busch Lab

ZMP

si:dkey-245p14.6

Ensembl ID:
ENSDARG00000061952
ZFIN ID:
ZDB-GENE-061207-65
Description:
proteasome-associated protein ECM29 homolog [Source:RefSeq peptide;Acc:NP_001155958]
Human Orthologue:
KIAA0368
Human Description:
KIAA0368 [Source:HGNC Symbol;Acc:29020]
Mouse Orthologue:
AI314180
Mouse Description:
expressed sequence AI314180 Gene [Source:MGI Symbol;Acc:MGI:2140220]

Alleles

There are 11 alleles of this gene:

Allele Name Consequence Status Availability
sa39595 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa32651 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa38256 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa39594 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa39593 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa32650 Nonsense Available for shipment Available now
sa6580 Nonsense Mutation detected in F1 DNA Not yet available
sa13229 Nonsense Available for shipment Available now
sa18481 Nonsense Available for shipment Available now
sa39592 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25562
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088949 Nonsense 233 1867 6 49

The following transcripts of ENSDARG00000061952 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 18334952)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18900120
GRCz11 1 19593057
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTTTATGCAGTTAAAAGAGTGATTGGAGAAGCTCAGTGGAGCCCAGAG[C/T]AACTGGAGCAGGTGAGGATTTTAAGAAAATGTGTTGTTCGATAATTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39595
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088949 Essential Splice Site 283 1867 7 49

The following transcripts of ENSDARG00000061952 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 18333492)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18898660
GRCz11 1 19591597
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACACAGTGTGGCTACAGCAGCTGATCTGGAACTTAAAAGCAAGCAGAGG[T/C]GAGGCCGTCTGTGATAAAATGACAAATAAAACCATCAACACTTACTAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32651
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088949 Essential Splice Site 309 1867 8 49

The following transcripts of ENSDARG00000061952 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 18333328)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18898496
GRCz11 1 19591433
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAACAGAATGTATAAAGTTTACCTGGGTGATATTCCACTTAAAACTAAA[G/A]TAAGTACATGTACACATGGGTGCTCAAATATCGTTATGTTTTTATGCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38256
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088949 Essential Splice Site 309 1867 8 49

The following transcripts of ENSDARG00000061952 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 18333327)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18898495
GRCz11 1 19591432
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAACAGAATGTATAAAGTTTACCTGGGTGATATTCCACTTAAAACTAAAG[T/C]AAGTACATGTACACATGGGTGCTCAAATATCGTTATGTTTTTATGCATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39594
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088949 Essential Splice Site 403 1867 11 49

The following transcripts of ENSDARG00000061952 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 18332662)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18897830
GRCz11 1 19590767
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTGATGCTGCTGAATGGACTTACCAAGCTTATCAATGAATATAAAGAGG[T/C]ATGAAAGCATGCTGAGTGATTGAATTTTAGTTGTTACTGGAATTGTAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39593
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088949 Essential Splice Site 483 1867 14 49

The following transcripts of ENSDARG00000061952 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 18331192)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18896360
GRCz11 1 19589297
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCACTTCTGAACCTGATGGAAGCACTTGTGGCTGCATATATCACAAAGG[T/G]TTGCTATTTACTTAGACAAACACGTAAAACATGAATTATACACTTCAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32650
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088949 Nonsense 516 1867 15 49

The following transcripts of ENSDARG00000061952 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 18330949)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18896117
GRCz11 1 19589054
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTTGCTCCTGATCATGTAGCCTCTAGATTTCTCTTGCTTCTGGCTGCT[G/T]GAGATCCGTAAGTATATATCTGCTCTTTAAGTTTTCTTTTCTTAACTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6580
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088949 Nonsense 1231 1867 34 49

The following transcripts of ENSDARG00000061952 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 18318381)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18883549
GRCz11 1 19576486
KASP Assay ID:
554-5049.1 (used for ordering genotyping assays)
KASP Sequence:
TTGTCCAATAGGTGTGTGTGCGCATGTGCGAATCYACAGGAGCTACTGCA[C/T]AGAGGACAGTGGCTGTGCTGTTGCCAACTCTTTTGGACAARGGCATCGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13229
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088949 Nonsense 1359 1867 37 49

The following transcripts of ENSDARG00000061952 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 18316404)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18881572
GRCz11 1 19574509
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTGGATGTGTCCGTGCTGGGAGAACTTGTTCCCAAACTATGTGATCTAT[T/G]AAAGAGTGGAATTGGACTTGGAACAAAGGTACACATCCTTSTAGATTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18481
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088949 Nonsense 1500 1867 41 49

The following transcripts of ENSDARG00000061952 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 18314479)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18879647
GRCz11 1 19572584
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGAGGCCGAGGAGGAGAAAGGAGAGAGCGCTGAAGCCAACCTGTGGTCT[G/T]AGGTTTGGCAGGAACACGTACCTGGTAGGTACTGGGCAAAAATTAATTKC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39592
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088949 Essential Splice Site 1657 1867 44 49

The following transcripts of ENSDARG00000061952 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 18311921)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18877089
GRCz11 1 19570026
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGATCGTTTTCATGAAGTCGCAGAGATTGTGCTTCCCCTCATTAAAAAG[G/T]TACAGTAAACCTGAATATAGCGGATTTCTCTCTCTCTTTTTAGTCTCTTC
Associated Phenotype:
Not determined