Busch Lab

ZMP

cngb3

Ensembl ID:
ENSDARG00000061945
ZFIN ID:
ZDB-GENE-090611-1
Human Orthologue:
CNGB3
Human Description:
cyclic nucleotide gated channel beta 3 [Source:HGNC Symbol;Acc:2153]
Mouse Orthologue:
Cngb3
Mouse Description:
cyclic nucleotide gated channel beta 3 Gene [Source:MGI Symbol;Acc:MGI:1353562]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
hu2483 Nonsense Available for shipment Available now
sa25215 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30119
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083904 Nonsense 59 585 3 16
ENSDART00000088953 None None 645 None 17
ENSDART00000113731 Nonsense 60 572 3 16
ENSDART00000135928 None None 238 None 5
ENSDART00000145337 None None 490 None 13
Genomic Location (Zv9):
Chromosome 24 (position 31128965)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 31478639
GRCz11 24 31415850
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTCACTCGTAGTGTGAATGCAGAATCCTTATATACGCTTCTTTTGGGCT[C/A]AAAATCAGAAATGAATAGCAAGCTTATGAATCAAAATCAAAACTGTGCTT
Long Flanking Sequence:
TATGATGGTTGGGTTTAGGCTTAGGTTTTTTGTTAGGTGTAGACAAAAATAACGATGATGGTTGCGTTTAGAGTTGTGGTAGGTAGGGTGCAGACGTTAATAACTGTGAAGGTTGGGTCTAGGTGTGGAGTAGGTGTAGACATTAATAACTGATATACACATCTTGCCAACAACATAGTTTTAAATCATGGTTCTCTATAGCTTCAAGTTAAGCCTCTAACGTACTACAAGTTACGCACCATCACGTTACACCCCTGTTCCGACCTTGATAATGTCTAAAGCAAAGAGTCACTCTTCATTTGTATAAAGCTGAAGGATTCTCAACATTGTCGCGTCACTCGACATGCCCACCTTTGTGCCAACGGTCGCTGTCGCTCGTGTAAACGGAGGTCGCTGGAAGTTGCTCGCTCTACGTTGAAATGCAAGGTCGCTTGTCGATTTGCCGATGCTAGTCACTCGTAGTGTGAATGCAGAATCCTTATATACGCTTCTTTTGGGCT[C/A]AAAATCAGAAATGAATAGCAAGCTTATGAATCAAAATCAAAACTGTGCTTATACAAATGAAATGTAAATCATTTCACTAATTATAAAACATAAACAAATAACGTTTAATACCATGGTTGATTTTCATAAGCGTTTAATGAAGTGCGCATCTCTGATTCTGAAGATTCGGTTTATAAATCAATCTGCTTTATATTTTAGGAGTTTCTTAAGCGTTATAAAAATAAACCTGACTCAGATTTCCTTAATACACAGCACCAGTTTACCGAAAGGAAGACTGGATCAGAAAACAAGAAGAGGAAAGAATAAAACGAGAAGAGGCTGAGCAGAAGAAAAAAGAGGATGACGCCAAGAGAGCTGCAGCGAAGAAGGAAAAGGAGGAGAAAGAAAAGAAGGAGAAAGAGGAAAAACTGAAAGCAGAGAAAGAGGCAGCTGATAAAGAGGCAGCTGAGGCCATGTTCCCTAAAATCAAATGCACATGTATAGACACCCTTCTCAAACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu2483
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083904 Nonsense 297 585 10 16
ENSDART00000088953 Nonsense 360 645 10 17
ENSDART00000113731 Nonsense 290 572 10 16
ENSDART00000135928 None None 238 None 5
ENSDART00000145337 Nonsense 195 490 6 13
Genomic Location (Zv9):
Chromosome 24 (position 31133729)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 31473875
GRCz11 24 31411086
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAAGATATCTGCGCTGTTATTACTTCGCCACTCGTACCCTGATCACTATC[G/T]GAGGTCTGCCGGAGCCCCATACGCTCTTCGAGATCGTCTTCCAGCTCGTC
Long Flanking Sequence:
TTAATTTCTTTGAACGTTACCAACATCCGGGGAAAATTTCAAGTCAACGGCACCTTTAGAAATATGTTTTCTGAGAAAAATGGTGACATGTTCAATACTTATTTTCCCTGCTTTATGTATGATGGATACACACACAGACACACAATACACATACACACAGTATTACGGATAGGATATTAGATAGGTATGTTTTTTTATATGTATCTAAATTGTGCACTGCATTAGACATCTTTTTTTACTTTAATTGCTTTAATTGTTCTAATTTGAAAGTGGTAAAAATGAATGGTAAATTCTTCCAAATGATTAAAAGTAAATATTTTTTGCATTGTTATCATTTTCAGTAGAGCTATTGAAAATTAAATAAAATGTAATACACTATTTAATTCAAAATTATATGCTATTGCATTTCTATAAATAAACATTGTACTAATTTGATAATATTACTTCTCTTAAGATATCTGCGCTGTTATTACTTCGCCACTCGTACCCTGATCACTATC[G/T]GAGGTCTGCCGGAGCCCCATACGCTCTTCGAGATCGTCTTCCAGCTCGTCAACTTCTTTACTGGAGTCTTTGTCTTCTCCAGCCTGATTGGACAGGTAAACAGAAAATATGGCACATAACTTCACATCGCTGAAAGTTGCTTACCATGCTCTGAATCCGTGTGCATTCAGATGCGAGACGTCATTGGAGCAGCTACGGCAGGTCAAACGTACTTCAGAGCATCTATGGATTCTTGCGTGGCGTATATGAACACCTACACCATTCCCAAACTGGTCCAGAGCAGAGTTCGCACCTGGTATAACTACACCTGGGACTCCCAGGGCATGCTGGGTAAGAGATTAGTGTAAAGTAGAAAGACTCAAGTGACTAATTGGGTAATGATAGTAGCTTATACAGAAACTTACTGTATGTAGATAGCAAATTATCTGGATCATCTGCAAAAATCTTAAATGCCCCACAGATGAATCGGAGTTATTAGACAAGATGCCGCTGGTGATGAG
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa25215
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083904 Nonsense 353 585 11 16
ENSDART00000088953 Nonsense 416 645 11 17
ENSDART00000113731 Nonsense 346 572 11 16
ENSDART00000135928 None None 238 None 5
ENSDART00000145337 Nonsense 251 490 7 13
Genomic Location (Zv9):
Chromosome 24 (position 31133974)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 31473630
GRCz11 24 31410841
KASP Assay ID:
554-7665.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGGCAGGTCAAACGTACTTCAGAGCATCTATGGATTCTTGCGTGGCGTA[T/A]ATGAACACCTACACCATTCCCAAACTGGTCCAGAGCAGAGTTCGCACCTG
Long Flanking Sequence:
TGCTTTAATTGTTCTAATTTGAAAGTGGTAAAAATGAATGGTAAATTCTTCCAAATGATTAAAAGTAAATATTTTTTGCATTGTTATCATTTTCAGTAGAGCTATTGAAAATTAAATAAAATGTAATACACTATTTAATTCAAAATTATATGCTATTGCATTTCTATAAATAAACATTGTACTAATTTGATAATATTACTTCTCTTAAGATATCTGCGCTGTTATTACTTCGCCACTCGTACCCTGATCACTATCGGAGGTCTGCCGGAGCCCCATACGCTCTTCGAGATCGTCTTCCAGCTCGTCAACTTCTTTACTGGAGTCTTTGTCTTCTCCAGCCTGATTGGACAGGTAAACAGAAAATATGGCACATAACTTCACATCGCTGAAAGTTGCTTACCATGCTCTGAATCCGTGTGCATTCAGATGCGAGACGTCATTGGAGCAGCTACGGCAGGTCAAACGTACTTCAGAGCATCTATGGATTCTTGCGTGGCGTA[T/A]ATGAACACCTACACCATTCCCAAACTGGTCCAGAGCAGAGTTCGCACCTGGTATAACTACACCTGGGACTCCCAGGGCATGCTGGGTAAGAGATTAGTGTAAAGTAGAAAGACTCAAGTGACTAATTGGGTAATGATAGTAGCTTATACAGAAACTTACTGTATGTAGATAGCAAATTATCTGGATCATCTGCAAAAATCTTAAATGCCCCACAGATGAATCGGAGTTATTAGACAAGATGCCGCTGGTGATGAGAACAGCAATCGCTGTGGATATCAACCTCGCTACTTTCCAGAAGATTGACCTTTTCAAGGTATGACAGTCTTTCGGCTTAGTCCCTTATTAAACTCATATAAATGTGTTCAGCTAATGTTGAAGATCTCTACAGTGGAAGCTTATTTCTGATGCAGAAAAAAAAAATAGTTGTGGCATATTATATTGAAATTCTGACAGCTCAAAAACAAGATAACTCAATTTAGATATCATCTTTATCATCATTT
Associated Phenotype:
Not determined