Busch Lab

ZMP

trpv4

Ensembl ID:
ENSDARG00000061941
ZFIN ID:
ZDB-GENE-030912-7
Description:
transient receptor potential cation channel subfamily V member 4 [Source:RefSeq peptide;Acc:NP_0010
Human Orthologue:
TRPV4
Human Description:
transient receptor potential cation channel, subfamily V, member 4 [Source:HGNC Symbol;Acc:18083]
Mouse Orthologue:
Trpv4
Mouse Description:
transient receptor potential cation channel, subfamily V, member 4 Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa1671 Nonsense Available for shipment Available now
sa15329 Nonsense Available for shipment Available now
sa26435 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2266
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088937 Nonsense 48 841 1 15
ENSDART00000138186 Nonsense 63 856 1 15
Genomic Location (Zv9):
Chromosome 5 (position 21616452)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19329324
GRCz11 5 19833124
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTCAATGGCAGCGCTACTGGAAAATGATGATGTATCACAGCCAACTCAT[G/T]AATTGCCTCGACCAGGACAACAGAACGACCAGAAGCAGAACATGCGGATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8180
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088937 Nonsense 345 841 5 15
ENSDART00000138186 Nonsense 360 856 5 15
Genomic Location (Zv9):
Chromosome 5 (position 21592500)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19305372
GRCz11 5 19809172
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACAACACACGTTTTGTCACTAAGATGTTTGACTTGCTGCTCATTAAATG[T/A]GCCAAACTCTACYCRGATTGCAACCTGGAGAATATACTCAACAACGACGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5288
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088937 Nonsense 620 841 11 15
ENSDART00000138186 Nonsense 635 856 11 15
Genomic Location (Zv9):
Chromosome 5 (position 21584057)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19296929
GRCz11 5 19800729
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAAGATTTGTTCCGGTTCCTGCTGKTCTACGTGCTCTTCATGATTGGTTA[T/A]GCTTCAGGTATTCCAATAAGAATCATCACTCTTGTTTAATATCTTCTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1671
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088937 Nonsense 641 841 12 15
ENSDART00000138186 Nonsense 656 856 12 15
Genomic Location (Zv9):
Chromosome 5 (position 21583903)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19296775
GRCz11 5 19800575
KASP Assay ID:
554-1617.1 (used for ordering genotyping assays)
KASP Sequence:
GTGTCGCTGTTGACCATCTGCCCTGATAAGGACACGTGTAAGGAAAACTG[T/A]CCTACATATCCCGAATGTCGAGACACAAACACCTTCAGTGAATTCTTGCT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa15329
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088937 Nonsense 764 841 13 15
ENSDART00000138186 Nonsense 779 856 13 15
Genomic Location (Zv9):
Chromosome 5 (position 21581754)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19294626
GRCz11 5 19798426
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGAGATGGTYACTGTGGGCAAGGGTTTGGATGGAAAGCCAGAYAAAYGCT[G/A]GTGCTTCAGRTACAGCAACAAAATATCTGCTACATTTATGTTTATTAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26435
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088937 Essential Splice Site 767 841 13 15
ENSDART00000138186 Essential Splice Site 782 856 13 15
Genomic Location (Zv9):
Chromosome 5 (position 21581744)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19294616
GRCz11 5 19798416
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTGTGGGCAAGGGTTTGGATGGAAAGCCAGACAAACGCTGGTGCTTCAG[G/A]TACAGCAACAAAATATCTGCTACATTTATGTTTATTAATTTATTATATAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2270
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088937 Nonsense 803 841 14 15
ENSDART00000138186 Nonsense 818 856 14 15
Genomic Location (Zv9):
Chromosome 5 (position 21581515)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19294387
GRCz11 5 19798187
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCCAGGCCAGAAAGACCTTTCTGAACACACACAGGGTGGACGGGGCCTT[C/T]GAAGAGGTWAGTTAAKGGGCAAATTATTTAAAAAAAACTATATTTTTGGT
Associated Phenotype:
Not determined