Busch Lab

ZMP

ENSDARG00000061928

Ensembl ID:
ENSDARG00000061928
Human Orthologues:
AC104809.3, CEP110, CEP250, CROCC, GOLGA4
Human Descriptions:
centrosomal protein 110kDa [Source:HGNC Symbol;Acc:1858]
centrosomal protein 250kDa [Source:HGNC Symbol;Acc:1859]
ciliary rootlet coiled-coil, rootletin [Source:HGNC Symbol;Acc:21299]
golgin A4 [Source:HGNC Symbol;Acc:4427]
Mouse Orthologues:
Cep110, Cep250, Crocc, Golga4
Mouse Descriptions:
centrosomal protein 110 Gene [Source:MGI Symbol;Acc:MGI:1889576]
centrosomal protein 250 Gene [Source:MGI Symbol;Acc:MGI:108084]
ciliary rootlet coiled-coil, rootletin Gene [Source:MGI Symbol;Acc:MGI:3529431]
golgi autoantigen, golgin subfamily a, 4 Gene [Source:MGI Symbol;Acc:MGI:1859646]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa22724 Essential Splice Site Available for shipment Available now
sa42625 Nonsense Mutation detected in F1 DNA Not yet available
sa35996 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa22724
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005194 Essential Splice Site 284 1065 10 13
Genomic Location (Zv9):
Chromosome 15 (position 42977656)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 44018098
GRCz11 15 44041541
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATATTTATTAATTGTTAGAATAAAATGATGAGTGTTCTTTTATTTTCCA[G/A]TCTTCTCCACAGAGTTCATGAGGTTTTAAAGCAGTGCCAAGATTTAAAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28540
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005194 Essential Splice Site 408 1065 12 13
Genomic Location (Zv9):
Chromosome 15 (position 42979053)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 44016701
GRCz11 15 44040144
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAAAGCTCAGTCTCAGGAGAGAGGAGAGGTGCTGGGGCCCATCATGGAG[G/A]TGAGATGCTTTGATGTGATCACTTTCACACTTTTTTGTTAATAAAGAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42625
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005194 Nonsense 879 1065 13 13
Genomic Location (Zv9):
Chromosome 15 (position 42981329)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 44014425
GRCz11 15 44037868
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAAGGAAAAGGTTGGAAATTTGCAGGAACTTCTAGACGCTGCTAACCAT[G/T]GAATTGCTGAAAAAGAGCATCACTTAGAGTCGTTGAATCAAAGTCTGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35996
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005194 Nonsense 974 1065 13 13
Genomic Location (Zv9):
Chromosome 15 (position 42981615)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 44014139
GRCz11 15 44037582
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCATCGTTCCCAACAGGATTTTTCTGATTTACAGACTGACCACAATGTTT[T/A]GAAGGAAAAACTGGTTAATCTTCAGGATCAAGTAGAGCAGGCGATGATTA
Associated Phenotype:
Not determined