Busch Lab

ZMP

amotl2a

Ensembl ID:
ENSDARG00000061923
ZFIN ID:
ZDB-GENE-030131-9770
Description:
angiomotin-like protein 2 [Source:RefSeq peptide;Acc:NP_001073646]
Human Orthologue:
AMOTL2
Human Description:
angiomotin like 2 [Source:HGNC Symbol;Acc:17812]
Mouse Orthologue:
Amotl2
Mouse Description:
angiomotin-like 2 Gene [Source:MGI Symbol;Acc:MGI:1929286]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa44636 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa18416 Essential Splice Site Available for shipment Available now
sa20712 Essential Splice Site Available for shipment Available now
sa20713 Nonsense Available for shipment Available now
sa40700 Nonsense Mutation detected in F1 DNA Not yet available
sa18236 Nonsense Available for shipment Available now
sa16774 Splice Site, Nonsense Available for shipment Available now
sa33875 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa44636
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088914 None None 721 1 11
ENSDART00000139367 Essential Splice Site None 40 None 2
ENSDART00000141354 Essential Splice Site 19 185 None 2
ENSDART00000143974 None None 130 1 2
Genomic Location (Zv9):
Chromosome 6 (position 27700287)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28001498
GRCz11 6 27992059
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTGGAGAAGCTCTCCAGGCGCGCACGCACGAACATACGCATGGAAATG[T/G]AAGTCGTACTCAACATATTTCCAGAAGGATTATATCTTTAAACATAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18416
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088914 Essential Splice Site 306 721 3 11
ENSDART00000139367 None None 41 None 2
ENSDART00000141354 None None 185 None 2
ENSDART00000143974 None None 131 None 2
Genomic Location (Zv9):
Chromosome 6 (position 27702120)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28003331
GRCz11 6 27993892
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGAAAAGAGAAGTGGACAGCTACAGTGAGAAGGCGGCAAGGTTACAGAAG[G/A]TAACAGGATTCTTTGTGTGATTGCAASTTCSTTGCAACCTTCTAGAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20712
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088914 Essential Splice Site 306 721 3 11
ENSDART00000139367 None None 41 None 2
ENSDART00000141354 None None 185 None 2
ENSDART00000143974 None None 131 None 2
Genomic Location (Zv9):
Chromosome 6 (position 27702121)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28003332
GRCz11 6 27993893
KASP Assay ID:
2259-7601.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAAAGAGAAGTGGACAGCTACAGTGAGAAGGCGGCAAGGTTACAGAAGG[T/C]AACAGGATTCTTTGTGTGATTGCAACTTCCTTGCAACCTTCTAGAACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20713
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088914 Nonsense 345 721 4 11
ENSDART00000139367 None None 41 None 2
ENSDART00000141354 None None 185 None 2
ENSDART00000143974 None None 131 None 2
Genomic Location (Zv9):
Chromosome 6 (position 27703854)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28005065
GRCz11 6 27995626
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGAAGCCCTTGAGAAAACCATGAGGAACAAGCTAGAGAGTGAGATCAAG[C/T]GACTTCATGACTTTAACAGAGATCTCAGGGGTAAGATGGTTCGCATAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40700
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088914 Nonsense 425 721 6 11
ENSDART00000139367 None None 41 None 2
ENSDART00000141354 None None 185 None 2
ENSDART00000143974 None None 131 None 2
Genomic Location (Zv9):
Chromosome 6 (position 27705625)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28006836
GRCz11 6 27997397
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAAGAGGCGTCGTGAAGCCTTGGAGCAAGCACTTATCACAGCTCAGACA[C/T]GAAATAGGCAGCTGGAAGAAGAGTTACGTAGGAAGAGAGCTTATGTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18236
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088914 Nonsense 453 721 6 11
ENSDART00000139367 None None 41 None 2
ENSDART00000141354 None None 185 None 2
ENSDART00000143974 None None 131 None 2
Genomic Location (Zv9):
Chromosome 6 (position 27705710)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28006921
GRCz11 6 27997482
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGAGCTTATGTGGAGAAGGTGGAAAGGATGCAGAGTGCATTGGCRCAAT[T/A]GCAGGCAGCATGTGAGAAGAGGGAAGCWCTGGAGTTACGACTTAGRACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16774
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088914 Splice Site, Nonsense 482 721 6 11
ENSDART00000139367 None None 41 None 2
ENSDART00000141354 None None 185 None 2
ENSDART00000143974 None None 131 None 2
Genomic Location (Zv9):
Chromosome 6 (position 27705796)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28007007
GRCz11 6 27997568
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TACGACTTAGRACCAGACTGGAGCAGGAGCTGAAGAGTTTGAGAGCACAG[C/T]AGGTAAAAGAAAAAACAGACAACYTCTGTTCAATAAGAATCAACAATTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33875
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088914 Nonsense 652 721 10 11
ENSDART00000139367 None None 41 None 2
ENSDART00000141354 None None 185 None 2
ENSDART00000143974 None None 131 None 2
Genomic Location (Zv9):
Chromosome 6 (position 27707053)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28008264
GRCz11 6 27998825
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCAATTTCAGGGAAGAGCCTATCAGATGACCAGACAGCAGTCGCATCTT[T/A]GCCCCCATTGCCCCATCTGCTTGCCAAAATCCAGTGTCGAGACAGCAGCA
Associated Phenotype:
Not determined