Busch Lab

ZMP

si:dkey-119o24.1

Ensembl ID:
ENSDARG00000061922
ZFIN ID:
ZDB-GENE-050419-20
Description:
probable ATP-dependent RNA helicase DHX36 [Source:RefSeq peptide;Acc:NP_001122016]
Human Orthologue:
DHX36
Human Description:
DEAH (Asp-Glu-Ala-His) box polypeptide 36 [Source:HGNC Symbol;Acc:14410]
Mouse Orthologue:
Dhx36
Mouse Description:
DEAH (Asp-Glu-Ala-His) box polypeptide 36 Gene [Source:MGI Symbol;Acc:MGI:1919412]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa41078 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa21142 Essential Splice Site Available for shipment Available now
sa21143 Nonsense Available for shipment Available now
sa14771 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa41078
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109467 Essential Splice Site 466 1037 10 25
Genomic Location (Zv9):
Chromosome 7 (position 71121715)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 31734146
GRCz11 18 31712951
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAAATATCATGAGAGCTGGCCCTGCTATGCCCGTACACTTAGAGATCGG[T/A]AAGTCTTTTACTTTTTTCTGTTCTAGTTTTCCTAAAAAAAATCATGCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21142
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109467 Essential Splice Site 552 1037 13 25
Genomic Location (Zv9):
Chromosome 7 (position 71149740)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 31762171
GRCz11 18 31741078
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATCATCCCTCTCCACTCTCTGATGCCCACGGTCTCTCAAACCCAAGTTA[G/A]TAAGCTGTGACCAGCTCTCTGCCTTGCACAACAACCTTAAAATGAAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21143
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109467 Nonsense 635 1037 16 25
Genomic Location (Zv9):
Chromosome 7 (position 71174191)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 31786622
GRCz11 18 31765286
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCATTTGTTTTGTTTTTGTTTGATTAGAGTGTCCCCAGGAAAATGCTA[T/A]CATCTGTATAATGGACTCAGGGCCAGCCTCTTGGATAACTACCAGTTACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14771
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109467 Essential Splice Site 972 1037 25 25
Genomic Location (Zv9):
Chromosome 7 (position 71254671)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 31867102
GRCz11 18 31837558
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATTATGATCAWATTTCACAGGTTTGATTTTTTTTTTTTTCTGAAAATTT[A/G]GGACCTGAAAAAGGAGTTGGATGTATTACTGGAGGAAAAGATAAAGAGTC
Associated Phenotype:
Not determined