Busch Lab

ZMP

NPAS4 (2 of 3)

Ensembl ID:
ENSDARG00000061920
Description:
neuronal PAS domain protein 4 [Source:HGNC Symbol;Acc:18983]
Human Orthologue:
NPAS4
Human Description:
neuronal PAS domain protein 4 [Source:HGNC Symbol;Acc:18983]
Mouse Orthologue:
Npas4
Mouse Description:
neuronal PAS domain protein 4 Gene [Source:MGI Symbol;Acc:MGI:2664186]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29601
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088907 Nonsense 121 605 3 7
Genomic Location (Zv9):
Chromosome 21 (position 24868792)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25535290
GRCz11 21 25571895
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATATGTATGTTTCTTCAGGTGGATCTAGTGGCTCAGAGTGACAGCGTGTA[T/G]GATATTATAGACCCGGCTGATCACTTCATCATGAGGGGCAACCTTGTGCC
Long Flanking Sequence:
TACTAAAAACATCAATATAAAGAATAATAAAATGTCTTTTTTCATTTTTTTACCATTTTAAATGTATATAAAAAAACAGTGTTCAGATGTTTGTCAAATAAAATAAGTTTTTCTTTCTGCATTGTGAGCAATCTCTGTCCAGAGTTCTGAAAGTTGCTCTGTCTATGGTGCTGAAATTGACCTGTCTGTATGGATGTTGCTTTAACATTATTCCTTTTCTTTCTATCCTCATCAGCTGCAGCAGGTCACGGTATGAGCGGAAGCCTCTTGTCTTTGCCAGAGCTCTCGGATCTCTTACACACACTCCCAGGATTTCTCCTAGTGCTGACAAGTGAAGGAAAACTTCTGTATCTGTCGGACAATGTCGCAGAGCACCTGGGTCATTCCATGGTGAGGAGCATCAGTGCATATTTAACATTAATTTTATTTATTAATTGTATGTGAAACTAAATATGTATGTTTCTTCAGGTGGATCTAGTGGCTCAGAGTGACAGCGTGTA[T/G]GATATTATAGACCCGGCTGATCACTTCATCATGAGGGGCAACCTTGTGCCAATCACCACACCTGACACAGGTACTTTCAAATAGAACCACTAAGGATTATTGCATTCTTAAAATAGGTAGTGATCAGCAAGTAAAATTTACCTATGAAGAGTACTTGATTATTGTTTTGAAATGACCAAAACATTATATTGAATTATGCTACAAAGTAATGTCTAAAGTCATAACAATTCAGCATTTGATGTAAAAACACTTTTATTATTTGTTTTTGTCCAGACCGCCTCTTTCGCTGCCGGTTCAGCACTTCAAAGTTTGTAAGAAGGCAGGGATCTGGCAACAAACAGGCGATTGTTCGGGCTCGCTGTCTGCCACCTCCATACCATGCATCTCCCTACTGGACATCCAACCCAGTGTGGGTGTGTTTCTGCTCCCCATTGGAAGCTAGCATGCCTCAGCTATCAACATCCAGGAACCCTCTTCCGACTCCACCAGCGGAGCAGTCT
Associated Phenotype:
Not determined