Busch Lab

ZMP

git2a

Ensembl ID:
ENSDARG00000061915
ZFIN ID:
ZDB-GENE-060526-267
Description:
ARF GTPase-activating protein GIT2 [Source:RefSeq peptide;Acc:NP_001119925]
Human Orthologue:
GIT2
Human Description:
G protein-coupled receptor kinase interacting ArfGAP 2 [Source:HGNC Symbol;Acc:4273]
Mouse Orthologue:
Git2
Mouse Description:
G protein-coupled receptor kinase-interactor 2 Gene [Source:MGI Symbol;Acc:MGI:1347053]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa2250 Nonsense F2 line generated Not yet available
sa33567 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2250
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088881 Nonsense 192 750 6 19
Genomic Location (Zv9):
Chromosome 5 (position 21698884)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19411756
GRCz11 5 19915556
KASP Assay ID:
554-3327.1 (used for ordering genotyping assays)
KASP Sequence:
AGAAAGGGAACACTCCGCTGCACATCGCGGCTAAAGCAGGTCAAGTGTGC[C/T]AGGCTGAGCTTCTTTGCGTTTATGGGGCAGATCCTGGAGCTCCAGACTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33567
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088881 Nonsense 495 750 15 19
Genomic Location (Zv9):
Chromosome 5 (position 21687162)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19400034
GRCz11 5 19903834
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAAGCGAGAACAGCTCTCTGAGGCGGCAGGTCTCCGCTCAACAGCCCTA[T/A]CAGGCCCCCGGCGGCCCTGACCATCCCAATCCCTCCAGTCCCTCCTCCTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26439
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088881 Nonsense 551 750 15 19
Genomic Location (Zv9):
Chromosome 5 (position 21686996)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19399868
GRCz11 5 19903668
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTCTATGTATGAAACCGGCTCTGGCCTGAAGCCCTTTCTTCCCAAGGGC[G/T]AGACCCCTTACCCTGAGGAAACCTTCCCCACCCTGCAACCCTTCCCAGCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2204
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088881 Nonsense 706 750 19 19
Genomic Location (Zv9):
Chromosome 5 (position 21669893)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19382765
GRCz11 5 19886565
KASP Assay ID:
554-2531.1 (used for ordering genotyping assays)
KASP Sequence:
AACTCTCTGCGGTTATTAACGTCCAGTGCGAATCGGCTCCAGACCGAGTG[T/A]AAGAAAGCRTCTCCTCTGGAGAGCAGCCMKGCCTCAGACATGCAGTTGGT
Associated Phenotype:
Not determined