Busch Lab

ZMP

si:dkey-218h11.4

Ensembl ID:
ENSDARG00000061908
ZFIN ID:
ZDB-GENE-030131-4642
Description:
hypothetical protein LOC561964 [Source:RefSeq peptide;Acc:NP_001038437]
Human Orthologue:
C19orf28
Human Description:
chromosome 19 open reading frame 28 [Source:HGNC Symbol;Acc:28299]
Mouse Orthologue:
F630110N24Rik
Mouse Description:
RIKEN cDNA F630110N24 gene Gene [Source:MGI Symbol;Acc:MGI:3604804]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa19739 Nonsense Available for shipment Available now
sa25108 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa8957 Nonsense Mutation detected in F1 DNA Not yet available
sa11445 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19739
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088867 Nonsense 276 489 5 10
ENSDART00000099702 Nonsense 276 506 5 11
Genomic Location (Zv9):
Chromosome 2 (position 22546523)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 23433228
GRCz11 2 23088879
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTCAAATCTTCTCTAAACTCTGCTTTTTTATTCAGGTTGCACTGCTTTA[T/A]ATGTCCACCAGACTGATAGTAAACCTGTCACAAACATACATCTCCATGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25108
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088867 Essential Splice Site 390 489 7 10
ENSDART00000099702 Essential Splice Site 390 506 7 11
Genomic Location (Zv9):
Chromosome 2 (position 22548631)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 23435336
GRCz11 2 23090987
KASP Assay ID:
554-7415.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCTGGTCATGTCTCTTGCCATGACGGCTGAACTCATAGGAGACCAGACA[G/A]TAAGTATTGATCAAGCACATGCTATCAAACAAATGTTTTTCTGTGTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8957
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088867 None None 489 None 10
ENSDART00000099702 Nonsense 469 506 10 11
ENSDART00000088867 None None 489 None 10
ENSDART00000099702 Nonsense 469 506 10 11
Genomic Location (Zv9):
Chromosome 2 (position 22552714)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 23439419
GRCz11 2 23095070
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACTGATTCTCCTCATGGCTGACGTGTTGTTTTGTATTTCAGTATCTAAG[C/T]GAGGTCATATGAACGGTTCAATAAACGGCAATGGCTCAAAGGGTGAGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11445
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088867 None None 489 None 10
ENSDART00000099702 Nonsense 469 506 10 11
ENSDART00000088867 None None 489 None 10
ENSDART00000099702 Nonsense 469 506 10 11
Genomic Location (Zv9):
Chromosome 2 (position 22552714)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 23439419
GRCz11 2 23095070
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACTGATTCTCCTCATGGCTGACGTGTTGTTTTGTATTTCAGTATCTAAG[C/T]GAGGTCATATGAACGGTTCAATAAACGGCAATGGCTCAAAGGGTGAGGGT
Associated Phenotype:
Not determined