Busch Lab

ZMP

si:ch211-209d1.1

Ensembl ID:
ENSDARG00000061904
ZFIN IDs:
ZDB-GENE-041114-132, ZDB-GENE-041114-132, ZDB-GENE-081028-61
Description:
Zgc:103746 [Source:UniProtKB/TrEMBL;Acc:Q5U3C6]
Human Orthologue:
FHOD3
Human Description:
formin homology 2 domain containing 3 [Source:HGNC Symbol;Acc:26178]
Mouse Orthologue:
Fhod3
Mouse Description:
formin homology 2 domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1925847]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa12499 Nonsense Available for shipment Available now
sa12518 Nonsense Available for shipment Available now
sa36094 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa12499
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088818 Nonsense 194 1549 6 27
ENSDART00000131438 None None 847 None 11
ENSDART00000143185 Nonsense 194 320 6 9
ENSDART00000088818 Nonsense 194 1549 6 27
ENSDART00000131438 None None 847 None 11
ENSDART00000143185 Nonsense 194 320 6 9

The following transcripts of ENSDARG00000061904 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 20659800)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 18896555
GRCz11 16 18702194
KASP Assay ID:
2260-9512.1 (used for ordering genotyping assays)
KASP Sequence:
GTATGTAGAWGGAATGAATGGGCTTATCGGACACAATGAAACYGTACAGT[G/A]GCTGTACACACTGGTTGGAWCAAAGGTAAAGGACATTCSACGTCTAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12518
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088818 Nonsense 194 1549 6 27
ENSDART00000131438 None None 847 None 11
ENSDART00000143185 Nonsense 194 320 6 9
ENSDART00000088818 Nonsense 194 1549 6 27
ENSDART00000131438 None None 847 None 11
ENSDART00000143185 Nonsense 194 320 6 9

The following transcripts of ENSDARG00000061904 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 20659800)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 18896555
GRCz11 16 18702194
KASP Assay ID:
2260-9512.1 (used for ordering genotyping assays)
KASP Sequence:
GTATGTAGAWGGAATGAATGGGCTTATCGGACACAATGAAACYGTACAGT[G/A]GCTGTACACACTGGTTGGAWCAAAGGTAAAGGACATTCSACGTCTAAAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28635
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088818 Essential Splice Site 425 1549 11 27
ENSDART00000131438 None None 847 None 11
ENSDART00000143185 None None 320 None 9

The following transcripts of ENSDARG00000061904 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 20638406)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 18875161
GRCz11 16 18680800
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGATGAAGAGTTTCAGAAAGCAGCACTTTCTAGACAGGCATCTGGAAGG[T/G]ATTTTAGCAGAATAAGATTGCCGGGTGTAGAGCAGGGATTGTCACACTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36094
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088818 Nonsense 1514 1549 26 27
ENSDART00000131438 Nonsense 812 847 10 11
ENSDART00000143185 None None 320 None 9

The following transcripts of ENSDARG00000061904 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 20567520)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 18804275
GRCz11 16 18609914
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAAATCAGCCACTCAGGGCCCCAGTCAGAGAACACAGCCTCGTGAGAGG[A/T]GACGTTCCAGAGCAAACCGCAAATCCTGTGAGTCTCAAACACTAATTAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2882
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088818 Nonsense 1537 1549 27 27
ENSDART00000131438 Nonsense 835 847 11 11
ENSDART00000143185 None None 320 None 9

The following transcripts of ENSDARG00000061904 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 20566625)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 18803380
GRCz11 16 18609019
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTCGACAGTGAGAAGAACACTGAAGAACGGTCTTACCCCRGAGGAGGCA[C/T]AGGCTCTGGGTTTGGCCAGCGGCTCTGAGATGCAGGTGTGAGACAGCAGA
Associated Phenotype:
Not determined