Busch Lab

ZMP

atp13a2

Ensembl ID:
ENSDARG00000061890
ZFIN ID:
ZDB-GENE-061215-126
Description:
probable cation-transporting ATPase 13A2 [Source:RefSeq peptide;Acc:NP_001073506]
Human Orthologue:
ATP13A2
Human Description:
ATPase type 13A2 [Source:HGNC Symbol;Acc:30213]
Mouse Orthologue:
Atp13a2
Mouse Description:
ATPase type 13A2 Gene [Source:MGI Symbol;Acc:MGI:1922022]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa1158 Essential Splice Site Available for shipment Available now
sa14250 Nonsense Available for shipment Available now
sa18624 Nonsense Available for shipment Available now
sa3236 Essential Splice Site F2 line generated Not yet available
sa6735 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa1158
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088777 Essential Splice Site 493 1170 15 29
ENSDART00000132265 None None 75 None 4
Genomic Location (Zv9):
Chromosome 23 (position 24820924)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24607044
GRCz11 23 24533585
KASP Assay ID:
554-1069.1 (used for ordering genotyping assays)
KASP Sequence:
CGCCTCGCATTAACATCTGTGGCAAGAWATCACTTTTCTGCTTTGATAAG[G/A]TGAGACAATGCGATTTGYKAAGATGATCTATATCACTTCATTWGAAATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14250
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088777 Nonsense 718 1170 20 29
ENSDART00000132265 None None 75 None 4
Genomic Location (Zv9):
Chromosome 23 (position 24809841)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24595961
GRCz11 23 24522502
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGTGATGAAGAACCAAGTGAAGCCAGAAAGTGCTGAAGTCATTCAAACTT[T/A]AACTCTGGCACAGTTACGGCCTGTGATGGTTACAGGTACGTACAAAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18624
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088777 Nonsense 819 1170 22 29
ENSDART00000132265 None None 75 None 4
Genomic Location (Zv9):
Chromosome 23 (position 24807205)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24593325
GRCz11 23 24519866
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTATAAATGGGATGTCCTTTGCAGCACTTTGTGATCATTTCCCTGAATA[T/G]CTACCCAAGGTGACTTGGATTGAGTTTTACAAATATTGATTCATTCCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3236
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088777 Essential Splice Site 900 1170 24 29
ENSDART00000132265 None None 75 None 4
Genomic Location (Zv9):
Chromosome 23 (position 24803833)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24589953
GRCz11 23 24516494
KASP Assay ID:
554-3217.1 (used for ordering genotyping assays)
KASP Sequence:
CCCTTCACATCCAAATCTGACAACATCAGCTGCGTGCCTTTACTCATCAA[G/T]TAAATGACACGTTGTTATGTTGTTATCTATTCGATAAAGTGTRTTGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6735
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088777 Essential Splice Site 1116 1170 29 29
ENSDART00000132265 None None 75 None 4
Genomic Location (Zv9):
Chromosome 23 (position 24800253)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24586373
GRCz11 23 24512914
KASP Assay ID:
554-4828.1 (used for ordering genotyping assays)
KASP Sequence:
TMYGAAACACACTCTTAGTAACTCATCTTTTATTCTTTTTTATATCCACA[G/A]TTTTTCATTGACCAAGGTGCCCTGAACTGCCTTCGAAACCTCAGAGGAAA
Associated Phenotype:
Not determined