Busch Lab

ZMP

si:dkey-149i17.9

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa39832 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa30819 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa16089 Nonsense Available for shipment Available now
sa18395 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39832
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088795 Essential Splice Site 44 258 2 5
ENSDART00000134936 None None 212 None 3
ENSDART00000088795 Essential Splice Site 44 258 2 5
ENSDART00000134936 None None 212 None 3
Genomic Location (Zv9):
Chromosome 2 (position 24667949)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25242726
GRCz11 2 24898360
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGTGGCAATTAAGTTTGCCAACACCAAGAACGTCAAGTTCATCGACATT[G/A]TAAGTATGCTGTGCTCTTCTACTCTCATTCACTGTTTCATTTCACCTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30819
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088795 Essential Splice Site 44 258 2 5
ENSDART00000134936 None None 212 None 3
ENSDART00000088795 Essential Splice Site 44 258 2 5
ENSDART00000134936 None None 212 None 3
Genomic Location (Zv9):
Chromosome 2 (position 24667949)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25242726
GRCz11 2 24898360
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGTGGCAATTAAGTTTGCCAACACCAAGAACGTCAAGTTCATCGACATT[G/A]TAAGTATGCTGTGCTCTTCTACTCTCATTCACTGTTTCATTTCACCTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16089
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088795 Nonsense 157 258 3 5
ENSDART00000134936 Nonsense 113 212 1 3
Genomic Location (Zv9):
Chromosome 2 (position 24667477)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25242254
GRCz11 2 24897888
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCCTGATCAAYCCAGACACCCTYGAAGTCAAATTGATCGACTTTGGATG[C/A]GGGGAAATCCTCACCGATGCTCCTTACAGAGRTTTTGCTGGTATGTATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18395
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088795 Nonsense 211 258 4 5
ENSDART00000134936 Nonsense 167 212 2 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 24666816)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25241593
GRCz11 2 24897227
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGTCTCTCGGAGTACTCCTTTATGCGATGATGTGTGGGGAGTTTCCAAAT[C/T]GACACGACCTGCAAATGATCAGATATAACATCTGGACCAAAGATCACTTG
Associated Phenotype:
Not determined