Busch Lab

ZMP

satb2

Ensembl ID:
ENSDARG00000061885
ZFIN ID:
ZDB-GENE-070912-212
Description:
DNA-binding protein SATB2 [Source:RefSeq peptide;Acc:NP_001122004]
Human Orthologue:
SATB2
Human Description:
SATB homeobox 2 [Source:HGNC Symbol;Acc:21637]
Mouse Orthologue:
Satb2
Mouse Description:
special AT-rich sequence binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:2679336]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa31727 Nonsense Available for shipment Available now
sa11148 Essential Splice Site Available for shipment Available now
sa7194 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa31727
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088791 Nonsense 69 737 2 10
ENSDART00000088876 Nonsense 69 834 2 11
Genomic Location (Zv9):
Chromosome 9 (position 33629003)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 32784949
GRCz11 9 32595695
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTCGTGCTCTCTTGCAGGTTTGATGATTCCTGTCTTCTGCGTGGTGGAG[C/T]AGATGGATGGAGGGATGATTTCCGATGGAGAGAGCCGAGAGGAACATGCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27430
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088791 Nonsense 81 737 2 10
ENSDART00000088876 Nonsense 81 834 2 11
Genomic Location (Zv9):
Chromosome 9 (position 33628967)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 32784913
GRCz11 9 32595659
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGCGTGGTGGAGCAGATGGATGGAGGGATGATTTCCGATGGAGAGAGC[C/T]GAGAGGAACATGCTGAGTTTGTGCTGGTCAGGAAGGACATCCTCTTCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11148
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088791 None None 737 None 10
ENSDART00000088876 Essential Splice Site 250 834 6 11
Genomic Location (Zv9):
Chromosome 9 (position 33612703)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 32768649
GRCz11 9 32579395
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTTTTAGGYGATTATTTGTGGCAAGGACGGGAGGGCTCAGAAATCAAGG[G/T]TAAGCTCTAAAGTATCTTTGGGTAAAGGACTGACTTTGATTTCTTAGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7194
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088791 Nonsense 716 737 10 10
ENSDART00000088876 Nonsense 730 834 11 11
Genomic Location (Zv9):
Chromosome 9 (position 33594022)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 32749968
GRCz11 9 32560714
KASP Assay ID:
554-5043.1 (used for ordering genotyping assays)
KASP Sequence:
CTGGATCTGCCCAAACATACCATTGTTAAGTTCTTTCAGAACCAACGTWA[T/A]CATGTGAAGCATCATGGACGACTGAAGGAGCTCGGATCGGAGGGCGGCGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27429
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088791 Nonsense 723 737 10 10
ENSDART00000088876 Nonsense 737 834 11 11
Genomic Location (Zv9):
Chromosome 9 (position 33594003)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 32749949
GRCz11 9 32560695
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCATTGTTAAGTTCTTTCAGAACCAACGTTATCATGTGAAGCATCATGGA[C/T]GACTGAAGGAGCTCGGATCGGAGGGCGGCGGTGTAGACGTGGCTGAGTAT
Associated Phenotype:
Not determined