Busch Lab

ZMP

myo18l1

Ensembl ID:
ENSDARG00000061862
ZFIN ID:
ZDB-GENE-080423-1
Human Orthologue:
MYO18A
Human Description:
myosin XVIIIA [Source:HGNC Symbol;Acc:31104]
Mouse Orthologue:
Myo18a
Mouse Description:
myosin XVIIIA Gene [Source:MGI Symbol;Acc:MGI:2667185]

Alleles

There are 9 alleles of this gene:

Allele Name Consequence Status Availability
sa18136 Essential Splice Site Available for shipment Available now
sa42546 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa22645 Splice Site, Nonsense Available for shipment Available now
sa22646 Nonsense Available for shipment Available now
sa2798 Nonsense F2 line generated Not yet available
sa42547 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa18136
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088648 Essential Splice Site 411 2057 3 41
Genomic Location (Zv9):
Chromosome 15 (position 23370851)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24082038
GRCz11 15 24017303
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGAGCACGATGGGACTGTACTGGATGTRGATGAGGATGAYGTAGAAAAGG[T/G]CAGTCTTGCGATGCTCATCACATTACTGGCATTTCAGTATGCACACATAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2826
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088648 Nonsense 488 2057 5 41
Genomic Location (Zv9):
Chromosome 15 (position 23377104)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24088291
GRCz11 15 24023556
KASP Assay ID:
2260-8487.1 (used for ordering genotyping assays)
KASP Sequence:
ATGCACATGTTCAAAGGCTGTCGACGGGAGGACACGGCTCCTCATATATA[T/A]GCARTGGCCCAGTCCGCCTACAGAAACCTTTTGACAACACGACAGGACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42546
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088648 Essential Splice Site 927 2057 15 41
Genomic Location (Zv9):
Chromosome 15 (position 23400799)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24111986
GRCz11 15 24047251
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGAAAGACTCTTCAGTTATTACAGTCCTGCGGATGGAGAGAGCAAAGG[T/A]CAACACACATCCCACATGCTCACACACACACGTCATTGCATGTAGATGTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2806
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088648 Nonsense 1280 2057 23 41
Genomic Location (Zv9):
Chromosome 15 (position 23426052)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24137239
GRCz11 15 24072504
KASP Assay ID:
554-2980.1 (used for ordering genotyping assays)
KASP Sequence:
AGCTGCTCAAGTCGAAGCTGGAGAAGGTAGAAAAGGAGAGGAACGAGTTG[A/T]GACTCAATAGCGACCGGTTGGAAARCAAGGTATGTGCTGAAGTCACAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22645
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088648 Splice Site, Nonsense 1329 2057 24 41
Genomic Location (Zv9):
Chromosome 15 (position 23429467)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24140654
GRCz11 15 24075919
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTCCGAGACCTCGGAGAGACTGAGGCTGGAGAAAGACATGAAGGATCTA[C/T]AGGTACAACACACCCACACACTTCAGAACAGATTCAGAGTTTTGACTTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28450
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088648 Essential Splice Site 1410 2057 26 41
Genomic Location (Zv9):
Chromosome 15 (position 23435169)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24146356
GRCz11 15 24081621
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGACAAACTAGAGGTGGAGCAGCAAAACAAGAGGCAGCTGGAGAGAAAAG[T/A]AAGGACTACTCACCCACACATTGTTGGTTTTATTTAGATTTTGTTAGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22646
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088648 Nonsense 1682 2057 32 41
Genomic Location (Zv9):
Chromosome 15 (position 23450041)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24161228
GRCz11 15 24096493
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGCTGATGCTCAGATCATGCTGGATCACCTGAAGAACAATGCACCCAGC[A/T]AGAGAGAGATCGCCCAGCTCAAGAACCAGGTCTGTTGTTCATCTCCCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2798
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088648 Nonsense 1770 2057 35 41
Genomic Location (Zv9):
Chromosome 15 (position 23456175)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24167362
GRCz11 15 24102627
KASP Assay ID:
554-2826.1 (used for ordering genotyping assays)
KASP Sequence:
GAGGAATTCAGAATGWTTGACCCCWGTCTGGTGCATTCTTTTGCAGTCCT[C/A]ACAGAACTTGGCCCAGATCAGTGACCTACAGGCCCAGCTGGAGGAGGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42547
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088648 Nonsense 1775 2057 35 41
Genomic Location (Zv9):
Chromosome 15 (position 23456189)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24167376
GRCz11 15 24102641
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATTGACCCCTGTCTGGTGCATTCTTTTGCAGTCCTCACAGAACTTGGCC[C/T]AGATCAGTGACCTACAGGCCCAGCTGGAGGAGGCTATGAAGGAGAAACAG
Associated Phenotype:
Not determined