Busch Lab

ZMP

olfml3a

Ensembl ID:
ENSDARG00000061852
ZFIN ID:
ZDB-GENE-060825-31
Description:
Olfactomedin-like protein 3B [Source:UniProtKB/Swiss-Prot;Acc:Q0P3W2]
Human Orthologue:
OLFML3
Human Description:
olfactomedin-like 3 [Source:HGNC Symbol;Acc:24956]
Mouse Orthologue:
Olfml3
Mouse Description:
olfactomedin-like 3 Gene [Source:MGI Symbol;Acc:MGI:1914877]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa37707 Nonsense Mutation detected in F1 DNA Not yet available
sa17438 Nonsense Available for shipment Available now
sa710 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4217
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088697 Nonsense 58 394 2 3
Genomic Location (Zv9):
Chromosome 23 (position 25078938)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24865058
GRCz11 23 24791599
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CACTCTGGCATGAGCAGAACAACCGCTACAACTCTGACCTGAAGGAGTTC[A/T]GACAGCAGGCCGCAGATCTGTTGGAGAAACTTAGCAAAGACCACAGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37707
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088697 Nonsense 97 394 2 3
Genomic Location (Zv9):
Chromosome 23 (position 25079055)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24865175
GRCz11 23 24791716
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGGTGCAGGTGCAAGAGTGGATCGAGTGGAACGTGAGATGGACTACATC[G/T]AAACCAAGAATCCCCCAAAGCCTTGTGTGAAAGCAGCGGACAAAATGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17438
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088697 Nonsense 220 394 3 3
Genomic Location (Zv9):
Chromosome 23 (position 25084221)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24870341
GRCz11 23 24796882
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGAAYGGCACAGGTCATGCAGTCTACGATGGCTTCCTATATTAYATCART[G/T]AAAGCTCAGAGCTCCAAGTGGTTAAATATGACCTGAYGAACAGTTCGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa710
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088697 Nonsense 359 394 3 3
Genomic Location (Zv9):
Chromosome 23 (position 25084640)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24870760
GRCz11 23 24797301
KASP Assay ID:
554-0618.1 (used for ordering genotyping assays)
KASP Sequence:
CCTCTGATTTATTTCCCCAGGCGTTAYGGGGCCCATTCCAGCCTCAAATA[C/A]AACCCTGAGGAACGTCAGCTCTACGCTTGGGATGATGGGTATCAGATTCT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461