Busch Lab

ZMP

ENSDARG00000061850

Ensembl ID:
ENSDARG00000061850
Human Orthologue:
CAPN5
Human Description:
calpain 5 [Source:HGNC Symbol;Acc:1482]
Mouse Orthologue:
Capn5
Mouse Description:
calpain 5 Gene [Source:MGI Symbol;Acc:MGI:1100859]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa6077 Nonsense Mutation detected in F1 DNA Not yet available
sa34042 Nonsense Mutation detected in F1 DNA Not yet available
sa34043 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa20907 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa6077
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088686 Nonsense 52 641 1 13
Genomic Location (Zv9):
Chromosome 7 (position 21633537)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 20223973
GRCz11 7 20475941
KASP Assay ID:
554-3723.1 (used for ordering genotyping assays)
KASP Sequence:
CAGCCGAGTCGCTCTTCTACAGAAGGACGCCCCCTCCAGGACTGACATGG[A/T]AGAGACCCAGCGTATGAGTATCCTTTTTTGATTGTGCAAGTGCTAANNNNTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34042
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088686 Nonsense 245 641 5 13
Genomic Location (Zv9):
Chromosome 7 (position 21635270)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 20225706
GRCz11 7 20477674
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATTTTTTGTGTGTTACAGCCAGCAGAAGGGGAGGCTTTAGAATCAGTTT[T/A]GGACTGTGGACTAATAAAAGGTCATGCATATGGTGTGACTGCTGTCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34043
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088686 Essential Splice Site 495 641 10 13
Genomic Location (Zv9):
Chromosome 7 (position 21657675)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 20248111
GRCz11 7 20500079
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCCTGGTGCTACTGGGCGGTTCCTTCTGCGTTTTTTCTCACACTCACAT[G/A]TGCGCCTCAGGTAGAGACAAGAGAATTGGCCCTTTGCTAGCTCTGCTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20907
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088686 Essential Splice Site 585 641 12 13
Genomic Location (Zv9):
Chromosome 7 (position 21659587)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 20250023
GRCz11 7 20501991
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAAAGCGATTTTTTACAGCAGGAAGCTGAAGTCAAAAATCTCCATTGAGG[T/G]CAGAAGCTAAACCACACTGTATTTTGATCATGTTTTATCATTGGCATATA
Associated Phenotype:
Not determined