Busch Lab

ZMP

SNTG1

Ensembl ID:
ENSDARG00000061832
Description:
syntrophin, gamma 1 [Source:HGNC Symbol;Acc:13740]
Human Orthologue:
SNTG1
Human Description:
syntrophin, gamma 1 [Source:HGNC Symbol;Acc:13740]
Mouse Orthologue:
Sntg1
Mouse Description:
syntrophin, gamma 1 Gene [Source:MGI Symbol;Acc:MGI:1918346]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa44174 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa24538 Nonsense Available for shipment Available now
sa32494 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44174
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088609 Essential Splice Site 55 526 3 17
Genomic Location (Zv9):
Chromosome 24 (position 36772222)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 35391032
GRCz11 24 35277529
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATACAGAGACTCTGTGGCATGAAAGTGACGCGTTTGCTTTGATTGTGTGC[A/G]GGAAAGAACAGTAACGATCCGTCGGCAGACAATCGGAGGGTTTGGTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24538
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088609 Nonsense 218 526 9 17
Genomic Location (Zv9):
Chromosome 24 (position 36764808)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 35383934
GRCz11 24 35270431
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCGATGGGTGGATCTGCGCCTTATCCCGCTCTTACATGCTCGCCTGTCC[C/T]AGTACGTCCCAGGTACTGACATTTGCAGGTGAGCTGAGCATATGGGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32494
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088609 Nonsense 240 526 10 17
Genomic Location (Zv9):
Chromosome 24 (position 36764310)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 35383436
GRCz11 24 35269933
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATTTCATCAGGCAAAACGCCTTTCAAGTCATCGCGGTGGACGGAGTGTG[C/A]AGCGGGGTAATTCAGTGTCCCGGTACTGACGAATGCACCGATTGGCTGCA
Associated Phenotype:
Not determined