Busch Lab

ZMP

prss12

Ensembl ID:
ENSDARG00000061830
ZFIN ID:
ZDB-GENE-090313-45
Human Orthologue:
PRSS12
Human Description:
protease, serine, 12 (neurotrypsin, motopsin) [Source:HGNC Symbol;Acc:9477]
Mouse Orthologue:
Prss12
Mouse Description:
protease, serine, 12 neurotrypsin (motopsin) Gene [Source:MGI Symbol;Acc:MGI:1100881]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa14034 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14034
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088653 Nonsense 631 776 12 13
ENSDART00000140263 Nonsense 522 667 10 11
Genomic Location (Zv9):
Chromosome 1 (position 18867702)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 19436617
GRCz11 1 20129554
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGCAGACAGTARTGACTATGACCTGGCAYTTCTGCGTGTTTCTGGACAC[A/T]GAGCKCAYAGGGGTGTCACGGGCCAATGCRTCACACTGAGCCGATCAGTG
Long Flanking Sequence:
CATAATTCATGCTATTAACTCCTGGCTTATTACCTGCTTATTATTAAGATATTAACTATTAATTAGTAGCAGAATTACCTTATTCTGGCACTCTAAGCCTATTCAAAACCTTAACCCAACTTCTACCATAAACAAGTAATTACTTGGGTGTCATACATTCTTGCTAGATTAGGTTTCTAGCAAAGTTTCCAATGAAAGCAGATAACCAATATCGTAACTATATTCTGCACAGATGTTCAATTCATGAGTGGATGTGTTTACAAAACAATTGGTGATGTCAATAACAATTCTGAGGTTTAGTTATACTGAATGTTTGGTATATGCTTTTTCTCAGGTATGGGAACAGCACAGGGCTGTATAAAGTTCGTGTTGGTGATTATCACTCTCTGGTCCCTGAGGAGTATGAGGAAGAGTATGCCGTGGAGAAGATCGTCCTTCACCCACGCTACCATGCAGACAGTAGTGACTATGACCTGGCACTTCTGCGTGTTTCTGGACAC[A/T]GAGCTCACAGGGGTGTCACGGGCCAATGCGTCACACTGAGCCGATCAGTGCTGCCCGCTTGTTTACCAGTGCGGAGAGAGAAAGTGCCAAAGGGCATTGCCAACTGCTACATCACAGGCTGGGGAGATACAGGTTAGAGATACGTAGCATGAAACACACATTCAAGTTATTTTGTTGTGCATATATATTGTCACAGCAAATATGGCGATAAGTGCTAGTGTTCTCATTTTAAGACCATTTTATGTCCCGGATAACATAATGATTATACAACAGCGTAGAAATGCAAATAGGCATTAACCAGCTCAGGCTCATTGGAAGTATGTGCCTAAATTTTTTTTTGCAAAATATAAAATACTTTGCTACGGGTACGTTTTGTTGTACATTTCAGATACATATCCTTGCAGAGCTTATTGGACAGATCACCTAGCGAACTACTGATCTAAGCCCTTCTCTGAACCCAACCAATAGTGTTTTCATTAGCAAACCTAATGCCAATGCAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4842
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088653 Nonsense 776 776 13 13
ENSDART00000140263 Nonsense 667 667 11 11
Genomic Location (Zv9):
Chromosome 1 (position 18876790)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 19445705
GRCz11 1 20138642
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TATACACCAAAGTCTCCGCCTTTGTGCCCTGGATTAAGAAAGTTATTGGC[C/T]AGTAGAAAATTATGGTGAACAAAATAGTATTMTGACTTTGTGGGCATAAA
Long Flanking Sequence:
ATGACCACGTCGTATTGTAAATCACCAGTGGCGTTTTCGAGCAAGTCCTTAACAGTATTCTGAAGTGAAATGAATGAAGTATGTGTTGCTGCAGCACTAAGAACAAAGTAACTCCACACTTGGTTGCATGCTTGAACAGTTAAGCCTGATCACTTCCAGACTGCAAGTTAAAAGGATTTCTGACCTTTTTATCCTCAGGTCGTGCATATTCCAAAACTCTCCAGCAGGCCTCCATTTCTGTGTTGAGCAAGCGTCAGTGTGAGCAGCGCTACTCGGAGCAGTTCACCAATCGTATGCTGTGCGCCGGCTCGTCCCATGATGCCCAGCGTGTGGACTCCTGCCGTGGCGATAGCGGTGGTCCGCTGGTGTGCGAGAGGCCAAGCGGGAGCTGGGTTGTTTATGGGGTCACATCATGGGGTCACGCGTGTCGCCTGCAGGAAGCACCCGGGGTATACACCAAAGTCTCCGCCTTTGTGCCCTGGATTAAGAAAGTTATTGGC[C/T]AGTAGAAAATTATGGTGAACAAAATAGTATTCTGACTTTGTGGGCATAAACAATGAAGCACATTTTAGATAATATTTTGAAAACTATTTCTTAACACTAGCTGAAATTACCTTTTAAACAAGTCTTAAATGCCAGAGAGAAAGGCTACGCTTTGCTTTAAAGGGGCTATATGTACGCATTTTCATGTATTTTATTGCCATTGTGAGGTTTATGAAAGGTTGTAGACTGATACTGTAGTTGTGAAGGACACAAAAGGATATGGTGTTTACAAACGCTCCTGAGAGCCTCTCTTTTCTTCTTTGGCACATGAACGAGTGCTATAAAAATGCTTAAGATCATGCTGAAAGAGCCGTACTGTAATGTCAATGTGTCAAACGAAGAAAGGAGATTCATTTAAATCACATCTTGTGGATGTTTAGTCTGTAGTAGGGATGTACGATGTTGATTAATTAATTTAATTAACGTTAAAAGTAAACCTTTGTGACTAGTCTAACAAACCC
Associated Phenotype:
Not determined