Busch Lab

ZMP

zgc:162316

Ensembl ID:
ENSDARG00000061802
ZFIN ID:
ZDB-GENE-070410-70
Description:
CCR4-NOT transcription complex subunit 2 [Source:RefSeq peptide;Acc:NP_001082993]
Human Orthologue:
CNOT2
Human Description:
CCR4-NOT transcription complex, subunit 2 [Source:HGNC Symbol;Acc:7878]
Mouse Orthologue:
Cnot2
Mouse Description:
CCR4-NOT transcription complex, subunit 2 Gene [Source:MGI Symbol;Acc:MGI:1919318]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa38099 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa44329 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa38099
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088383 None None 520 None 15
ENSDART00000134072 None None 110 1 4
ENSDART00000139965 Essential Splice Site None 174 None 6
ENSDART00000148366 None None 188 None 4
Genomic Location (Zv9):
Chromosome 25 (position 29546537)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 28236631
GRCz11 25 28679833
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAATGCACTTTAAAGCGGCTTATATAGCCTTGGGTCTTGTTCTGCAGTGG[T/A]AATTCATTATTTATTACTAGTTCTCAGTGTTGCTGTGTAGAAGAACTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44329
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088383 Essential Splice Site 197 520 6 15
ENSDART00000134072 None None 110 None 4
ENSDART00000139965 None None 174 None 6
ENSDART00000148366 None None 188 None 4
Genomic Location (Zv9):
Chromosome 25 (position 29560050)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 28250144
GRCz11 25 28693346
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGGGGTTTGGAATGAACTCCTTATCCAATAACATCTTCAACGGGACAGG[T/C]GAGTGATGTTCATGACAGGAAACACGAGTGTGTTTTAGAAAGAGGAAGTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3321
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088383 Nonsense 498 520 15 15
ENSDART00000134072 None None 110 None 4
ENSDART00000139965 None None 174 None 6
ENSDART00000148366 None None 188 None 4
Genomic Location (Zv9):
Chromosome 25 (position 29579567)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 28269661
GRCz11 25 28712863
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATCAGCTGTGTTCTTTYCTCTGGTCTCCACAGGAGTTTCACCTGGAATA[C/A]GACAAGCTAGAAGAGCGGCCTCACGTGCCAACAACCTTCAATTACAATCC
Associated Phenotype:
Not determined