Busch Lab

ZMP

si:dkey-13n15.4

Ensembl ID:
ENSDARG00000061784
ZFIN ID:
ZDB-GENE-060526-210
Description:
rho GTPase-activating protein 25 [Source:RefSeq peptide;Acc:NP_001119876]
Human Orthologue:
ARHGAP25
Human Description:
Rho GTPase activating protein 25 [Source:HGNC Symbol;Acc:28951]
Mouse Orthologue:
Arhgap25
Mouse Description:
Rho GTPase activating protein 25 Gene [Source:MGI Symbol;Acc:MGI:2443687]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa1027 Nonsense F2 line generated Not yet available
sa20383 Nonsense Available for shipment Available now
sa31427 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26449
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088506 Essential Splice Site 111 600 4 10
Genomic Location (Zv9):
Chromosome 5 (position 22973642)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20686514
GRCz11 5 21190314
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTAGGGCTAAGCCTGCAATGCAATAAAATGGTTTTTTCTTTCTTCAAA[G/A]TATTTGGGAAAAGCCTTTCAGACATCATGGTGTATGAGAGAAAATTTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1027
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088506 Nonsense 227 600 6 10
Genomic Location (Zv9):
Chromosome 5 (position 22977019)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20689891
GRCz11 5 21193691
KASP Assay ID:
554-0931.1 (used for ordering genotyping assays)
KASP Sequence:
CGACTAACTGCATTTAATCTGATCAATCCAAGGGCAAAGAGAAGCTGGAG[A/T]AACAAATTAGTTTACTGCCAAAAGTGAACTACAACCTCCTGAGTTACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20383
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088506 Nonsense 228 600 6 10
Genomic Location (Zv9):
Chromosome 5 (position 22977022)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20689894
GRCz11 5 21193694
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTAACTGCATTTAATCTGATCAATCCAAGGGCAAAGAGAAGCTGGAGAAA[C/T]AAATTAGTTTACTGCCAAAAGTGAACTACAACCTCCTGAGTTACATCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31427
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088506 Nonsense 384 600 9 10
Genomic Location (Zv9):
Chromosome 5 (position 22983899)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20696771
GRCz11 5 21200571
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAAGCACAACTCTTTCTCCCACTGAGTTTTCGGTCACAACAGACACATG[G/A]CCCGAGAGCCCTAGAAAGCGGACACAAACTCTACCCAGTTTAGGTTGTCC
Associated Phenotype:
Not determined