Busch Lab

ZMP

ahnak

Ensembl ID:
ENSDARG00000061764
ZFIN IDs:
ZDB-GENE-030131-8719, ZDB-GENE-030131-8719
Description:
Ahnak protein [Source:UniProtKB/TrEMBL;Acc:Q08BG5]
Human Orthologue:
AHNAK
Human Description:
AHNAK nucleoprotein [Source:HGNC Symbol;Acc:347]
Mouse Orthologue:
Ahnak
Mouse Description:
AHNAK nucleoprotein (desmoyokin) Gene [Source:MGI Symbol;Acc:MGI:1316648]

Alleles

There are 13 alleles of this gene:

Allele Name Consequence Status Availability
sa42400 Nonsense Mutation detected in F1 DNA Not yet available
sa22488 Nonsense Available for shipment Available now
sa35698 Nonsense Mutation detected in F1 DNA Not yet available
sa22489 Nonsense Available for shipment Available now
sa28316 Nonsense Mutation detected in F1 DNA Not yet available
sa42401 Nonsense Mutation detected in F1 DNA Not yet available
sa42402 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa13008 Essential Splice Site Available for shipment Available now
sa17896 Nonsense Available for shipment Available now
sa6345 Nonsense Mutation detected in F1 DNA Not yet available
sa22490 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42400
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088484 Nonsense 211 848 5 5
ENSDART00000125289 Nonsense 211 5689 3 5
Genomic Location (Zv9):
Chromosome 14 (position 27785826)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 26478623
GRCz11 14 26776728
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTTCAAAATTCAGCTCTTGCAGCATGAGCAGGAAGGGGGTGATTCTTCA[C/T]AAATAGGATTACCACACAGCAGCCTTGTTAGCAGTGAACACGGGGGTAAA
Long Flanking Sequence:
GATTTTATTCTAGCCAAAATAAAACAAATAAGCCTTTCTCCAGAAGAAAAAATATTAGAGGAAATGCTGTTAAAATTCCATGCTCTGTTAAACATAATTTGGGAAATATTTATAAAAAAAAAACGCTATTAATTTTGACTTCAACTTATAGTCGTTTTGAATAATCGTGATTATGATTTTTCCCAAAATCGAGCAGCCCTATCTTATGTAATAATGTCCTTTTTTTCTTGTAGAGTGGGGATGATGAAGACTACAAGAGAATCTATAGCAAGAAGATTAAACCTAGACTGAAGTCTGAGGACCTTGCTGAGGGTGTTGATGTGCGCACAGAACGCCACAGCAGCACAAGCAGTGATGGTTGCACCATCACTACAATCACTCGACGAATAACTACCTACACAGTTGATATGCCTGGGGGCACTAGTCAGCAGATTGATCCCTCAAGTCCTGAGTTCAAAATTCAGCTCTTGCAGCATGAGCAGGAAGGGGGTGATTCTTCA[C/T]AAATAGGATTACCACACAGCAGCCTTGTTAGCAGTGAACACGGGGGTAAAAATTTAGGGGACATATCTTTTGGTGGGCCCCATGTCACTGGCTCGTCTGTGAAGCACTGTAGCACAGGATCTATCAGAGCAACAAGTGAATTAGATGGCAGTGGGAGAGAGATTACAATTAATGTGTCAGACACTGGACTTTCAGGGGGAAGAGGACAAAGATTTACAGAACATTTTGTAGGGACTGAAACTTCTCTAGAAGGTAATTTCTCTGGTAGAGTAACCACAGGGTTAGAAAAACAAGTGGGAAATATTTCTTCACCAGTAGAAGCTAGTTTTAAAGCTTTAAGTACGAAAGGAGGAACAGTAAAGGGCTCTGTTCTGGAAACGCATGGTTCAGGCTTTTCCATAATTGGAGGATCTAAGGGCAGTATTGGCAGAGAATCTTCTTCTGAAGTACTTAAGGATGGATCTGATGATCTAACCAAGCTGTCCAAGTTTAGCATAGAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3886
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088484 Nonsense 783 848 5 5
ENSDART00000125289 Nonsense 783 5689 3 5
Genomic Location (Zv9):
Chromosome 14 (position 27787542)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 26480339
GRCz11 14 26778444
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGTTGAAGGGGCAAAAAGTGGAGGGTCCAGGTTTTGATGTAAAAATCTCC[A/T]AAGCTGATGTTGAACTTAAGGAATCAAATTTAAACATTAAAGCTTCAAAG
Long Flanking Sequence:
CATCAATTTCCGGTACATCTGTGCAAAATGTAAACATCACAGGACCTGCTGGGACAGCAGGGGACTTCAGCATTTCTGCTCCAAAAACGGAAGGAGATATTAAAGCACCATCCATTGAAATCAAAGGTCCAAAATTGATGGGTTCTAATGTAGACTTAAATCTTCCTAAAGCAGAAATAGAAAACAAACAAACAGGCGTAGAAATTAGGCTTCCCTCAAAGCCTGATATTGAGGGAGCTGATGGAAAAATCACATACCCAGAATTCAAGAAGACATCAATCACTGGGCCGAATATTTCTATGCCAGAAGTCAACTTGAACATCAAAGGTCAGAAATTGAAAGGCAGTGTTGAAACATCTGTTCCAAAAGTGGAAGGACATATTAAAGAACCAGAAGTAGCAGTTGAAAGACAAGATGGTCCTGAGAGGGGTTTTGGGATGCCAATATTTGGGTTGAAGGGGCAAAAAGTGGAGGGTCCAGGTTTTGATGTAAAAATCTCC[A/T]AAGCTGATGTTGAACTTAAGGAATCAAATTTAAACATTAAAGCTTCAAAGCTTGACACTGAGAGATCTGATGGAACAATCAAAGACAATAAAATCGTTATGCCTTCTGTTTCTGGGCCAACGATTTATATGCCGGGTGCTGATTTTAACCTGACAGGCTCTAAACTAAAAGGAGATGTTGATGCGTCCCTTCCAAAAATTGAAGGAGATATTAAAGCTTATGATATGGACTATAAAGCTCCAAAACATAACATTGACAGACCTGAGGGGAAACTTAAGAGCCCTGAATTCAATATGCCATCAGTATCTGGGCCAAATATTTCTATGCCAGATGTTGACTTAAATCTTAATGGTTCGAAACTGAAAGCTGATGTTGATGTTGATGTTTCTGTTTCGAAAGTGAAAGGAGATATTAAGGTACCTGATGTGGACATTAAACCTCCAAAAGTTGACATTAAGGTACCTGAGGTGGAAATCAAGGGCCCAAAATTCAATATGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22488
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088484 None None 848 None 5
ENSDART00000125289 Nonsense 2806 5689 3 5
Genomic Location (Zv9):
Chromosome 14 (position 27793611)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 26486408
GRCz11 14 26784513
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGACATTAAGGCACCTGATTTGGACATTAAATCTCCAGAGATTGACATT[G/T]AGGGACCTGAGGGAAAAGTAAAGGGGTCCAAGTTCAAAATACCTTTCTCT
Long Flanking Sequence:
GTGGTTTGAAAATGCCAACGATCAAAATGCCAAAATTCGGATTCAAGGGTCCAAAAGTTGAAGGACCAGGCATGGATGTGAAAAGCCCCAAGACTGACATTGATATTAAAGGACCTGATGTGGACATTAAGGCTCCAGAGCTTGACATTGAGGCACCTAAGGGAAACATCAAGGACCCCAAGCTGAAAATGCCTTCATTGTCCAGGCCAACAATTTCTATGCCAGATGTTGACTTTAACCTCAAAGGTCCGAAACTGAAAGGTGATGTTGATGTTTCTGTTCCAAAAGTGCAAGGAGATATTAAAGCACCAAAAGTCGAACTTGAAGGATCAGACATTGCGGGTCCTGAGGGTGGCTTTAAGATGCCAAAAATAAAAATGCCACAGATCGGATTCAAGGGTCCAAAAGTGGAAGGTCCAGATGTCGATGTAAAAATTCCCAAAACGGATATTGACATTAAGGCACCTGATTTGGACATTAAATCTCCAGAGATTGACATT[G/T]AGGGACCTGAGGGAAAAGTAAAGGGGTCCAAGTTCAAAATACCTTTCTCTGGGCCAAAAATTTCTATGCCTGATGTTGATTTCAACCTGAAAGGTCCGAAACTGAAAGGTGATGTTGATGTTTCTGTTCCTAAAGTGGAAGGAGATATTACAGCACCAAAAGTCCAACTTGAAGGCCCAGAAATTGAGGGTCCTGAGGGTGGTTTTAAAATGCCAACGATCAAAATGCCCAAATTCGGATTCAAGGGTCCAAAAGTTGAAGGACCAGGCATAGATGTAAAAAGCCCCAAGACTGACATTGATATTAAAGGATGTGATGTGGACATTAAGGCTCCAGAGCTTGACATTGAGGCACCTGAGGGAAACATCAAGGACCCCAAACTGAAAATGCCTTCATTGACCAGGCCAACAATTTCTATGCCAGATGTTGATTTTAACCTGAAAGGTCCAAAACTGAAAGGTGATGTTAATGTTTCTGTTCCAAAAGTGGAAGGAGATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35698
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088484 None None 848 None 5
ENSDART00000125289 Nonsense 3269 5689 3 5
Genomic Location (Zv9):
Chromosome 14 (position 27795000)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 26487797
GRCz11 14 26785902
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAAAGGTGATGTTTCTGTTCCAAAAGTGGAAGGAGATATTAAAGCACCA[A/T]AAGTCGAACTTGAAGGCCCAGAAATTGAGGGTCCAGAAGGTGGCTTTAAG
Long Flanking Sequence:
TTGAGGGACCTGAAGGAAAACCTAAGGGCTCTAAATTCAGTATCCCATCAATATCTGGCCCAAATATTTCCATGCCAGATGCTGATTTTAGCCTCAAAGGTCCGAAACTGAAAGGTGATGTTGATGTTTCAGTTCCAAAAGTAGAAGGGGATATCAAAGCTCCAAACGTTGAAATTGAAGGCCCAGATATTAAAGGACCTGAGGGTGGTTTTAAGATGCCAAAGATCAAAATGCCAAGATTTGGGTTCAAAGGTCCAAAAGTGGAAGGTCCAGATGTCGAAGTCCCCAAAACTGATATTGACATCAAAGCACCTGATGTGGACATTAAATCTCCTGAGCTTGACTTTGAGGGACCTGAAGGCAAGGTCAAGGGCTCCAAGTTTAAAATGCCTTTCTCTGGGCCAACGATTTCTATGCCTGATGTTGATTTTAACCTGAAAAGTCCAAAACTGAAAGGTGATGTTTCTGTTCCAAAAGTGGAAGGAGATATTAAAGCACCA[A/T]AAGTCGAACTTGAAGGCCCAGAAATTGAGGGTCCAGAAGGTGGCTTTAAGATGCCAAATATCAAAATGCCAAAATTCGGATTCAAGGGTCCAAAAGTTGAAGGTCCAGATGTCGATATAAAAATTCCCAAAACTGATATCGACATTAAGGCACCTGATGTGGACATCAAAGGTCCAGAGATTGACATTGAGGGACCGGAGGGAAAAGTTAAGGGCTCCAAGTTCAAAATACCTTTCTCTGGGCCAACAATTTCTATGCCGGATGTTGATTTTAACCTGAAAGGTCCGAAACTGAAAGGTGATGTTGATGTTTCAGTTCCAAAAGTGAAAGGAGAGATTAAAGCACCTGACGTGGTTGTTAAAACCCCAAAAGTTGACATTGAGGGACCTGAAGGAAAACTTAAGGGCCCTAAATTTAACATTCCATCAATTTCTGGGCCAAATATTTCTATGCCTGATGTTGACTTTAACCTGAAAGGTCCAAAACTGAAAGGTGATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22489
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088484 None None 848 None 5
ENSDART00000125289 Nonsense 4172 5689 4 5
Genomic Location (Zv9):
Chromosome 14 (position 27799806)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 26492603
GRCz11 14 26790708
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCATGCCAAAGATTTCTATGCCAGAAGTTGATTTCAATCTGAAAGGACCA[A/T]AACTGAAAGGTGATGTTGATTTTTCCGTTCCAAAAGTCGAAGGAGACGTA
Long Flanking Sequence:
TTGACATTGAGGGACCTGACGGAAAAGTCAAGGGCCCCACATTGAAAATGCCTTCTTTGTCCGGGCCAAAAATTTCTATGCCAGATGTTGATTTTAATCTGAAAGGTCCGAAAGTAAAAGGCGATGTTGATGTTTCTGTTCCAAAAGTGGAAGGAGATATAAAAGTCCCTGGTTTGGACATTAAAGCTCCAAAAGTTGACATTGAGGGACCAGAGGGAAAACTTAAGGGCCCTAAAATTAATATTCCTTCAATATCTGGCCCAAATATTTCCTTGCCAACTGTTGACTTTAACCTCAAAGGTCCAAAACTGAGAGGTGATGTTGATGTTTCTGTTCCCAAAGTGAAAGGAGATGTTAAAGCACCCGATCTGGATATTAAAACTCCTGAAATTGACATTGAGGGAGCTGAGGGAAAAATTAAGGGCCCTAAATTTAGGATACCATCTGTCTCCATGCCAAAGATTTCTATGCCAGAAGTTGATTTCAATCTGAAAGGACCA[A/T]AACTGAAAGGTGATGTTGATTTTTCCGTTCCAAAAGTCGAAGGAGACGTAAAGGCACCTGATGTTCATATCAAGGGTCCAGAGGTTGACGTAGAGACACCTGAAGGAAAAATCACAGGCTCCAAATTCAAGGGGCCATCATTTTCAGGTCCAAATATTTCTCTCCCAGATGTTGACTTCAACTTGAAAGGACCTAAACTAAAGGGTGGTGTTGATGTGTCCGTTCCAAAAGTTCAAGGGGATATTAAAGCCACAGATTTTAACATTAATCTGCCGAATATTGATGGTGATATACCTGAAGGAAAAGTAAAGGGCCCAAAACTTAAGATGCCATCTTTATCCGGCCCTGAAGGCTCCATTGAGGTTAATTTACCAGAAACAAATGTGAAAAAGCCAAAGTTTAAAATGCCAAAGTTTAAATTTCCGTCATTTGGGCACAAAGGTCCAAAAGTGGAAGGCCCTGATGTTGATGTAAAAATTCCTAAGGCTGATATCAAATTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28315
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088484 None None 848 None 5
ENSDART00000125289 Nonsense 4318 5689 4 5
Genomic Location (Zv9):
Chromosome 14 (position 27800244)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 26493041
GRCz11 14 26791146
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAAGCCAAAGTTTAAAATGCCAAAGTTTAAATTTCCGTCATTTGGGCAC[A/T]AAGGTCCAAAAGTGGAAGGCCCTGATGTTGATGTAAAAATTCCTAAGGCT
Long Flanking Sequence:
TACCATCTGTCTCCATGCCAAAGATTTCTATGCCAGAAGTTGATTTCAATCTGAAAGGACCAAAACTGAAAGGTGATGTTGATTTTTCCGTTCCAAAAGTCGAAGGAGACGTAAAGGCACCTGATGTTCATATCAAGGGTCCAGAGGTTGACGTAGAGACACCTGAAGGAAAAATCACAGGCTCCAAATTCAAGGGGCCATCATTTTCAGGTCCAAATATTTCTCTCCCAGATGTTGACTTCAACTTGAAAGGACCTAAACTAAAGGGTGGTGTTGATGTGTCCGTTCCAAAAGTTCAAGGGGATATTAAAGCCACAGATTTTAACATTAATCTGCCGAATATTGATGGTGATATACCTGAAGGAAAAGTAAAGGGCCCAAAACTTAAGATGCCATCTTTATCCGGCCCTGAAGGCTCCATTGAGGTTAATTTACCAGAAACAAATGTGAAAAAGCCAAAGTTTAAAATGCCAAAGTTTAAATTTCCGTCATTTGGGCAC[A/T]AAGGTCCAAAAGTGGAAGGCCCTGATGTTGATGTAAAAATTCCTAAGGCTGATATCAAATTTAAATCACCAGATTTGGACAATGAATCTCCAGAGCTTAACATTGAGGGACCGAAGGGAAAAATCAAGGCCTCCAAATTTAGTATGCCAACAATTTCTGGTCCAAAGGTTTCAATGCCAGATGTTGATCTAAACCTGAAACGTCCGAAACTGAAAGGTGACGTTGATGTTTCAGTTCCAAAAGTAGAAGGAAATATTAGTGTACCTGATGTGGATCTTAAATCTCCTGAAGTGGAATTTGAGGGACCTGAGGGAAAAATTAAGGGCCCCAAAGGGAAAATTCCATTACTGTCAGGGCCAAATATTTCTATGCCACACGTTGACTTCAACCTCAAAGGTCCAAAATTGAAAAGTGATGTTGATGTTTCTGTCCTGAAAGTGGAAGGAGATATTAAAACACCAAAGATTGAACATGAAGGACCAGACATTGAGGGTCCTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28316
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088484 None None 848 None 5
ENSDART00000125289 Nonsense 4600 5689 4 5
Genomic Location (Zv9):
Chromosome 14 (position 27801090)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 26493887
GRCz11 14 26791992
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGATATAAAGGTCCCTGGTATGGACATTAAAGGTCCACAAGTTGACATT[G/T]AGGGACCTGAGGGGAAAATCAAGGGCTCTAAATTCAGTATGCCTTCAATA
Long Flanking Sequence:
TACTGTCAGGGCCAAATATTTCTATGCCACACGTTGACTTCAACCTCAAAGGTCCAAAATTGAAAAGTGATGTTGATGTTTCTGTCCTGAAAGTGGAAGGAGATATTAAAACACCAAAGATTGAACATGAAGGACCAGACATTGAGGGTCCTGAGGGTGGCTTTAAGATGCCAAAGCTCAAAATTCCACAGTTTGGATTCAAGGGCCCAAAAGTGGAAGGTCCAGACATGGATGTTAAAATCCCCAAAACCGATATTGACATTAATGCACCTGATGTCGACATTAAAGCTCCAGAGCTTGACATCGATGGACCTGAGGGAAAAATCAAGGGCCCTAAATTGACAAAGCCTTCTTTATCTGGGCCAACAATTTCTATGCCAGATGTTGATTTTAACCTAAAAGGTCGGAAAATGAAAGGTGATGTCGATGTGTCTGTTCCAAAATTGCAAGGAGATATAAAGGTCCCTGGTATGGACATTAAAGGTCCACAAGTTGACATT[G/T]AGGGACCTGAGGGGAAAATCAAGGGCTCTAAATTCAGTATGCCTTCAATATCTGGCCCAAAAATTTCCATGCCTAATGTTGACTTTAACCTCAAAGGGCCAAAACTAAAAGGTGATGTTGATGTTACAGTTCCAAAAGTAGAAGGAGACATGAAGGCACCAAAAGTTGAACTTGAAGGCCCAGACATTGAGGGTCCTGAGGGTGGTTTTAAGATGCCAAAGGTCAAAATGCCAAAAATTGGATTCAAGGGTCCAAAAGTTGAAGGTCCAGATGTTAATGTACAAATCCCTAAAACTGATATTGACATTAATGCACCCGATGTGGACATTAAATCTCCAGAGCTAGAAATTGAGGGACCTGAGGGTAAAGTCAAGGGCCACAAATTAAAAATGCCTTTCTCCGGCCCAACAATTTCTATGCCAGATGTTGATTTTAATCTAAAAGGTCTAAAACTGAAAGGTGATGTTGATGCATCTGCTCCGAAAGTGAAAGGAGATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42401
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088484 None None 848 None 5
ENSDART00000125289 Nonsense 4663 5689 4 5
Genomic Location (Zv9):
Chromosome 14 (position 27801279)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 26494076
GRCz11 14 26792181
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGAAGGAGACATGAAGGCACCAAAAGTTGAACTTGAAGGCCCAGACATT[G/T]AGGGTCCTGAGGGTGGTTTTAAGATGCCAAAGGTCAAAATGCCAAAAATT
Long Flanking Sequence:
AGTTTGGATTCAAGGGCCCAAAAGTGGAAGGTCCAGACATGGATGTTAAAATCCCCAAAACCGATATTGACATTAATGCACCTGATGTCGACATTAAAGCTCCAGAGCTTGACATCGATGGACCTGAGGGAAAAATCAAGGGCCCTAAATTGACAAAGCCTTCTTTATCTGGGCCAACAATTTCTATGCCAGATGTTGATTTTAACCTAAAAGGTCGGAAAATGAAAGGTGATGTCGATGTGTCTGTTCCAAAATTGCAAGGAGATATAAAGGTCCCTGGTATGGACATTAAAGGTCCACAAGTTGACATTGAGGGACCTGAGGGGAAAATCAAGGGCTCTAAATTCAGTATGCCTTCAATATCTGGCCCAAAAATTTCCATGCCTAATGTTGACTTTAACCTCAAAGGGCCAAAACTAAAAGGTGATGTTGATGTTACAGTTCCAAAAGTAGAAGGAGACATGAAGGCACCAAAAGTTGAACTTGAAGGCCCAGACATT[G/T]AGGGTCCTGAGGGTGGTTTTAAGATGCCAAAGGTCAAAATGCCAAAAATTGGATTCAAGGGTCCAAAAGTTGAAGGTCCAGATGTTAATGTACAAATCCCTAAAACTGATATTGACATTAATGCACCCGATGTGGACATTAAATCTCCAGAGCTAGAAATTGAGGGACCTGAGGGTAAAGTCAAGGGCCACAAATTAAAAATGCCTTTCTCCGGCCCAACAATTTCTATGCCAGATGTTGATTTTAATCTAAAAGGTCTAAAACTGAAAGGTGATGTTGATGCATCTGCTCCGAAAGTGAAAGGAGATATTAAAATACCCAATGTGGATATTAAAGGTCCTGAAGTTGACATTGAGGGACCTGGGAGAAAATTTAAGGGCCCTAAATTTCAGATGCCATCAGTTTCTGGGCCAAATATTTCCATGCCTGATGTTGACTTTACGATGCCAGATGTTGATGTAAACCTGAAAGGCCCAAAACTGAAAGGTGATGTCGATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42402
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088484 None None 848 None 5
ENSDART00000125289 Essential Splice Site 5299 5689 5 5
Genomic Location (Zv9):
Chromosome 14 (position 27803272)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 26496069
GRCz11 14 26794174
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGATGTTGATTTGCCATCGGCAAGCCTTAAAACTGACATTCAGACACCAG[A/G]TGCTAGTTTGGACAGTCCAGATTTGAAAACGAAAGGGGCAAAAGTAAAAA
Long Flanking Sequence:
TTCGGGTGGCAGTCTTTCAGTTCCTGAACAGGATGTTGAGGCAACCATAGATGCCAAAAGCCCTGATGTTACCCTCAGTGGACCAGATGCAAACATCAAAGTGCCAAAAACTAAGAAATCTAAATTTTCACTTGGAGTTAGGAGCCCAAAGTTAGATGCAGATATCCCTGATGCTGGTGGTAATTTTGAAGGACCTGACATGAATGTAGATGTCAAAGGAAAAAAGGGTAAATTCAAATTGCCAAAAGGGAAAGGGAAGTCTAAAACATTTGATGCTGATTTAAAGACGGAAATGGTCGAGTTGGAGACAAATGAACCTGAAATTCACATAAAGTCCACCAAAGTAAAGAAACCTTTTTTTGGAAGGTTACATTTTCCTGATGTGGAATTTGACATAAAATCTCCAAAAGTTAAAGCTAGTTCATCTGCATCTGGAACCATGAAATCATCAGATGTTGATTTGCCATCGGCAAGCCTTAAAACTGACATTCAGACACCAG[A/G]TGCTAGTTTGGACAGTCCAGATTTGAAAACGAAAGGGGCAAAAGTAAAAATGTCAAAATACAGCATGTCTAGCTCCAAACTAAAAACTTCAGACTTGGATGTTAGAGATGCAACATTGGAGATTCCAGAGAAGACCATGCATTCTCCAGATGTCAGTGTAGCAGGATCAGGGATTAATGGAAAACGCAGTGCTAAAATTGACATAGAAGGAAAAGTACAAAGTGTTGAGTCGGCAGTGCCATCTACAAATGTCAGCGGGGGGGTTATAGATGCTGATTTAGGTATCGCTGAACAGAAAGGAGTAAAAGGGAGCATTGGAATAGCTGGCTTTAATGTAGGAGGACAAAAGGAAGATACTGCAAGTGGGATAGGCTTGAAGTCAGATGCATCATTATCTGGTGGGATAGAGAATCAAGAAGGTAATTTAACATTTCCTAAAGTCAAAGTACCAAAGTTTGGTATTGCATTGCCTAGAGTAGAACCAAGAGAAATGCGAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13008
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088484 None None 848 None 5
ENSDART00000125289 Essential Splice Site 5299 5689 5 5
Genomic Location (Zv9):
Chromosome 14 (position 27803273)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 26496070
GRCz11 14 26794175
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GATGTTGATTTGCCATCGGCAAGCCTTAAAACTGACATTCAGACACCAGA[T/G]GCTAGTTTGGACAGTCCAGATTTGAAAACGAAAGGGGCAAAAGTAAAAAT
Long Flanking Sequence:
TCGGGTGGCAGTCTTTCAGTTCCTGAACAGGATGTTGAGGCAACCATAGATGCCAAAAGCCCTGATGTTACCCTCAGTGGACCAGATGCAAACATCAAAGTGCCAAAAACTAAGAAATCTAAATTTTCACTTGGAGTTAGGAGCCCAAAGTTAGATGCAGATATCCCTGATGCTGGTGGTAATTTTGAAGGACCTGACATGAATGTAGATGTCAAAGGAAAAAAGGGTAAATTCAAATTGCCAAAAGGGAAAGGGAAGTCTAAAACATTTGATGCTGATTTAAAGACGGAAATGGTCGAGTTGGAGACAAATGAACCTGAAATTCACATAAAGTCCACCAAAGTAAAGAAACCTTTTTTTGGAAGGTTACATTTTCCTGATGTGGAATTTGACATAAAATCTCCAAAAGTTAAAGCTAGTTCATCTGCATCTGGAACCATGAAATCATCAGATGTTGATTTGCCATCGGCAAGCCTTAAAACTGACATTCAGACACCAGA[T/G]GCTAGTTTGGACAGTCCAGATTTGAAAACGAAAGGGGCAAAAGTAAAAATGTCAAAATACAGCATGTCTAGCTCCAAACTAAAAACTTCAGACTTGGATGTTAGAGATGCAACATTGGAGATTCCAGAGAAGACCATGCATTCTCCAGATGTCAGTGTAGCAGGATCAGGGATTAATGGAAAACGCAGTGCTAAAATTGACATAGAAGGAAAAGTACAAAGTGTTGAGTCGGCAGTGCCATCTACAAATGTCAGCGGGGGGGTTATAGATGCTGATTTAGGTATCGCTGAACAGAAAGGAGTAAAAGGGAGCATTGGAATAGCTGGCTTTAATGTAGGAGGACAAAAGGAAGATACTGCAAGTGGGATAGGCTTGAAGTCAGATGCATCATTATCTGGTGGGATAGAGAATCAAGAAGGTAATTTAACATTTCCTAAAGTCAAAGTACCAAAGTTTGGTATTGCATTGCCTAGAGTAGAACCAAGAGAAATGCGAGAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17896
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088484 None None 848 None 5
ENSDART00000125289 Nonsense 5538 5689 5 5
Genomic Location (Zv9):
Chromosome 14 (position 27803992)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 26496789
GRCz11 14 26794894
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGAAGATGCTGATGCTACTAGTAAAGGTGCTGCTAAAGTGTCTAAGGAGT[T/A]GAGTCTTAGTTCTGGGGAACTGACAAGTGGCAAGTTAACAGTAGAGGAAA
Long Flanking Sequence:
AAGTGTTGAGTCGGCAGTGCCATCTACAAATGTCAGCGGGGGGGTTATAGATGCTGATTTAGGTATCGCTGAACAGAAAGGAGTAAAAGGGAGCATTGGAATAGCTGGCTTTAATGTAGGAGGACAAAAGGAAGATACTGCAAGTGGGATAGGCTTGAAGTCAGATGCATCATTATCTGGTGGGATAGAGAATCAAGAAGGTAATTTAACATTTCCTAAAGTCAAAGTACCAAAGTTTGGTATTGCATTGCCTAGAGTAGAACCAAGAGAAATGCGAGAAGATATAGGTTCGGGTGAATTGGCTGGTGGAGCTAAAGTTAGTTCTCAAGGTTTAGAAATGCAGAAAACTGATGTCAAAAGCAGTGGTGGCAAAGTGAAAGTAAAAATGCCGAAGCTGTTTGTCAAATCTAAATCTAAAGGTGGCAGTGCAGCTGATCTAACTGTTGAGGGAGAAGATGCTGATGCTACTAGTAAAGGTGCTGCTAAAGTGTCTAAGGAGT[T/A]GAGTCTTAGTTCTGGGGAACTGACAAGTGGCAAGTTAACAGTAGAGGAAAGCTCTGGATTTAAAGTTTCTCCAAAGAGTAAATCTGCCTCTCTTGACTTCTTTAAAAAGTCACGACATCACTCATCCTCTGTCAGTGAAGAGGGAGCCTTAGCTTCACCTGTTTCTACTGAAGGGCACTTACAAGCAGAAGCTGGCAATGTTTCTCTAGATGTTGGAGACACTAAGGTTAAAGGCAAAAAAGGAAAGTTGAAGTTCTCTACAATTGGAGGTTTTAGTTCAAAAAGTAAAGGTTCATATGAAGTGACTGATGAGAGTGAGGCTATGACTGAGAGTGCTAGTGGGGTTGCTCAGCCTTCAAAGAAGTCCAGAATGTCATCGTCATCTAGCAGTGATAGTGGTACAAAAGGTAGTATTCGGTTACCACAACTCGAGATATCAGTTTCACCAAAAAAATAAGTTTTTACGTTGATATCTAGGCACAGTTCAAATACATTTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6345
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088484 None None 848 None 5
ENSDART00000125289 Nonsense 5598 5689 5 5
Genomic Location (Zv9):
Chromosome 14 (position 27804172)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 26496969
GRCz11 14 26795074
KASP Assay ID:
554-4773.1 (used for ordering genotyping assays)
KASP Sequence:
TGTCAGTGAAGAGGGAGCCTTAGCTTCACCTGTTTCTACTGAAGGGCAMT[T/G]ACAAGCAGAAGCTGGCAATGTTTCTCTAGATGTTGGAGACACTAAGGTTA
Long Flanking Sequence:
TGGGATAGAGAATCAAGAAGGTAATTTAACATTTCCTAAAGTCAAAGTACCAAAGTTTGGTATTGCATTGCCTAGAGTAGAACCAAGAGAAATGCGAGAAGATATAGGTTCGGGTGAATTGGCTGGTGGAGCTAAAGTTAGTTCTCAAGGTTTAGAAATGCAGAAAACTGATGTCAAAAGCAGTGGTGGCAAAGTGAAAGTAAAAATGCCGAAGCTGTTTGTCAAATCTAAATCTAAAGGTGGCAGTGCAGCTGATCTAACTGTTGAGGGAGAAGATGCTGATGCTACTAGTAAAGGTGCTGCTAAAGTGTCTAAGGAGTTGAGTCTTAGTTCTGGGGAACTGACAAGTGGCAAGTTAACAGTAGAGGAAAGCTCTGGATTTAAAGTTTCTCCAAAGAGTAAATCTGCCTCTCTTGACTTCTTTAAAAAGTCACGACATCACTCATCCTCTGTCAGTGAAGAGGGAGCCTTAGCTTCACCTGTTTCTACTGAAGGGCACT[T/G]ACAAGCAGAAGCTGGCAATGTTTCTCTAGATGTTGGAGACACTAAGGTTAAAGGCAAAAAAGGAAAGTTGAAGTTCTCTACAATTGGAGGTTTTAGTTCAAAAAGTAAAGGTTCATATGAAGTGACTGATGAGAGTGAGGCTATGACTGAGAGTGCTAGTGGGGTTGCTCAGCCTTCAAAGAAGTCCAGAATGTCATCGTCATCTAGCAGTGATAGTGGTACAAAAGGTAGTATTCGGTTACCACAACTCGAGATATCAGTTTCACCAAAAAAATAAGTTTTTACGTTGATATCTAGGCACAGTTCAAATACATTTATTTTATTATGTCAGTCTAGATGATTATCGTAAATCTGGCTTTCATTGTAATTATAATGCACTGCCTTATAAACTGTTTCTTCAGTTTCCAAAAATGCTCTTTACAGGCATTGATATTATTTGAATCACAATTTAACTGTAAATAAGAGAAAACTGTAGGTAATTTTAAATTTTTTTTGTAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22490
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088484 None None 848 None 5
ENSDART00000125289 Nonsense 5615 5689 5 5
Genomic Location (Zv9):
Chromosome 14 (position 27804222)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 26497019
GRCz11 14 26795124
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACAAGCAGAAGCTGGCAATGTTTCTCTAGATGTTGGAGACACTAAGGTT[A/T]AAGGCAAAAAAGGAAAGTTGAAGTTCTCTACAATTGGAGGTTTTAGTTCA
Long Flanking Sequence:
CAAAGTTTGGTATTGCATTGCCTAGAGTAGAACCAAGAGAAATGCGAGAAGATATAGGTTCGGGTGAATTGGCTGGTGGAGCTAAAGTTAGTTCTCAAGGTTTAGAAATGCAGAAAACTGATGTCAAAAGCAGTGGTGGCAAAGTGAAAGTAAAAATGCCGAAGCTGTTTGTCAAATCTAAATCTAAAGGTGGCAGTGCAGCTGATCTAACTGTTGAGGGAGAAGATGCTGATGCTACTAGTAAAGGTGCTGCTAAAGTGTCTAAGGAGTTGAGTCTTAGTTCTGGGGAACTGACAAGTGGCAAGTTAACAGTAGAGGAAAGCTCTGGATTTAAAGTTTCTCCAAAGAGTAAATCTGCCTCTCTTGACTTCTTTAAAAAGTCACGACATCACTCATCCTCTGTCAGTGAAGAGGGAGCCTTAGCTTCACCTGTTTCTACTGAAGGGCACTTACAAGCAGAAGCTGGCAATGTTTCTCTAGATGTTGGAGACACTAAGGTT[A/T]AAGGCAAAAAAGGAAAGTTGAAGTTCTCTACAATTGGAGGTTTTAGTTCAAAAAGTAAAGGTTCATATGAAGTGACTGATGAGAGTGAGGCTATGACTGAGAGTGCTAGTGGGGTTGCTCAGCCTTCAAAGAAGTCCAGAATGTCATCGTCATCTAGCAGTGATAGTGGTACAAAAGGTAGTATTCGGTTACCACAACTCGAGATATCAGTTTCACCAAAAAAATAAGTTTTTACGTTGATATCTAGGCACAGTTCAAATACATTTATTTTATTATGTCAGTCTAGATGATTATCGTAAATCTGGCTTTCATTGTAATTATAATGCACTGCCTTATAAACTGTTTCTTCAGTTTCCAAAAATGCTCTTTACAGGCATTGATATTATTTGAATCACAATTTAACTGTAAATAAGAGAAAACTGTAGGTAATTTTAAATTTTTTTTGTAGATAGGAAATTCAGATTCAATCCAAAAATGTGTGTACTTAATATAAAAAAGAA
Associated Phenotype:
Not determined