Busch Lab

ZMP

zgc:153294

Ensembl ID:
ENSDARG00000061763
ZFIN ID:
ZDB-GENE-060929-204
Description:
spermatogenesis associated 5-like 1 [Source:RefSeq peptide;Acc:NP_001070056]
Human Orthologue:
SPATA5L1
Human Description:
spermatogenesis associated 5-like 1 [Source:HGNC Symbol;Acc:28762]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa28964 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa28964
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101660 Nonsense 612 748 6 9
ENSDART00000129459 Nonsense 612 748 7 10
Genomic Location (Zv9):
Chromosome 18 (position 4906767)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 5680279
GRCz11 18 5533141
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCACCTGCAGAAAGATTGCTCTGTTAGAAGGTGGAGATCAGGAGGACGTA[C/T]GACTACATCAGGTCAGAGTCGAGGATTATGCATATGTTTATTGTATTTAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4736
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101660 Essential Splice Site 615 748 6 9
ENSDART00000129459 Essential Splice Site 615 748 7 10
Genomic Location (Zv9):
Chromosome 18 (position 4906779)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 5680267
GRCz11 18 5533129
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGATTGCTCTGTTAGAAGGTGGAGATCAGGAGGACGTACGASTACATCAG[G/A]TCWGAGTCGAGGATTATGCATRTGTTNNNNNTATTTACTGAGTAAATTCT
Associated Phenotype:
Not determined