Busch Lab

ZMP

SH3PXD2A (2 of 2)

Ensembl ID:
ENSDARG00000061758
Description:
SH3 and PX domains 2A [Source:HGNC Symbol;Acc:23664]
Human Orthologue:
SH3PXD2A
Human Description:
SH3 and PX domains 2A [Source:HGNC Symbol;Acc:23664]
Mouse Orthologue:
Sh3pxd2a
Mouse Description:
SH3 and PX domains 2A Gene [Source:MGI Symbol;Acc:MGI:1298393]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa23047 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3992
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088478 Nonsense 126 763 4 9
Genomic Location (Zv9):
Chromosome 17 (position 20356818)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 20506829
GRCz11 17 20526665
KASP Assay ID:
2261-0906.1 (used for ordering genotyping assays)
KASP Sequence:
CTCCTGCTGCCTACCTAAAGAAAATCCAAGATGGCGTCACAGCCAGTAAC[C/T]WGCCAGCAGAGTCAAATAAAGCATCTGTTCAGGGCCAGGTGGAAATCATC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4010
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088478 Essential Splice Site 217 763 6 9
Genomic Location (Zv9):
Chromosome 17 (position 20355239)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 20505250
GRCz11 17 20525086
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTATGTAAAGCAATTAAACATTATTTTTCAATTTGTTTCCCCTTCAATCC[A/T]GAACCACCATCAAACAATCTTAAACCGCCTCCCCGTCGTGAAAACAGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23047
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088478 Nonsense 247 763 7 9
Genomic Location (Zv9):
Chromosome 17 (position 20355022)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 20505033
GRCz11 17 20524869
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGTGCTTCAGGGTTTTCAGCTGCCGCAGCCGCCGGATCCCCCTACTGTT[G/T]AAGCGGAGTATTACACCATCGCGGAGTTTCGCTCCTGCCTGACCGACGGC
Associated Phenotype:
Not determined