Busch Lab

ZMP

si:ch211-197g15.12

Ensembl ID:
ENSDARG00000061757
ZFIN ID:
ZDB-GENE-050208-389
Description:
Novel GTPase activating protein [Source:UniProtKB/TrEMBL;Acc:Q1LVY2]
Human Orthologue:
RABGAP1L
Human Description:
RAB GTPase activating protein 1-like [Source:HGNC Symbol;Acc:24663]
Mouse Orthologue:
Rabgap1l
Mouse Description:
RAB GTPase activating protein 1-like Gene [Source:MGI Symbol;Acc:MGI:1352507]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa10812 Nonsense Available for shipment Available now
sa19286 Nonsense Mutation detected in F1 DNA Not yet available
sa24140 Essential Splice Site Available for shipment Available now
sa43807 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa10812
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088460 Nonsense 63 1043 2 26
ENSDART00000139523 None None 302 None 8
ENSDART00000145769 None None 475 None 13
ENSDART00000088460 Nonsense 63 1043 2 26
ENSDART00000139523 None None 302 None 8
ENSDART00000145769 None None 475 None 13

The following transcripts of ENSDARG00000061757 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 17537373)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17288409
GRCz11 22 17313398
KASP Assay ID:
2261-6682.1 (used for ordering genotyping assays)
KASP Sequence:
GATGTCGTGGAATGGGAGTGAGCAGCTGGAGCGGGCGATGGAGGAGGTGT[T/A]GGATGATGTTGCTGATGGAGCAGGAGCTGAAMAGGAGAAGGGATGCACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19286
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088460 Nonsense 63 1043 2 26
ENSDART00000139523 None None 302 None 8
ENSDART00000145769 None None 475 None 13
ENSDART00000088460 Nonsense 63 1043 2 26
ENSDART00000139523 None None 302 None 8
ENSDART00000145769 None None 475 None 13

The following transcripts of ENSDARG00000061757 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 17537373)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17288409
GRCz11 22 17313398
KASP Assay ID:
2261-6682.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATGTCGTGGAATGGGAGTGAGCAGCTGGAGCGGGCGATGGAGGAGGTGT[T/A]GGATGATGTTGCTGATGGAGCAGGAGCTGAACAGGAGAAGGGATGCACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24140
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088460 Essential Splice Site 244 1043 6 26
ENSDART00000139523 None None 302 None 8
ENSDART00000145769 None None 475 None 13

The following transcripts of ENSDARG00000061757 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 17542261)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17293297
GRCz11 22 17318286
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCACATTAAACCCAATCTTTCAAACCCTTTTTTTATTTATTTATATTTTT[A/T]GGTTAGTCGCATCCTCTATAGCTTCTCGACGGCCTTCAAGCGTTCGGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43807
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088460 Splice Site, Nonsense 608 1043 14 26
ENSDART00000139523 None None 302 None 8
ENSDART00000145769 Splice Site, Nonsense 38 475 1 13

The following transcripts of ENSDARG00000061757 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 17623322)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17374257
GRCz11 22 17399235
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTTCAAAGACTCAGGCGGCGATGGCCAAGACTCTCTATACAAGATCTGC[A/T]AGGTGAGCTGAATGCTGCGAATCCTCCAGCCGTGACTCATTCCCTCTGTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4200
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088460 Splice Site, Nonsense 675 1043 16 26
ENSDART00000139523 None None 302 None 8
ENSDART00000145769 Splice Site, Nonsense 105 475 3 13
ENSDART00000088460 Splice Site, Nonsense 675 1043 16 26
ENSDART00000139523 None None 302 None 8
ENSDART00000145769 Splice Site, Nonsense 105 475 3 13

The following transcripts of ENSDARG00000061757 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 17629515)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17380450
GRCz11 22 17405428
KASP Assay ID:
2261-6685.1 (used for ordering genotyping assays)
KASP Sequence:
ACAACTTTGAAGATCTTCATTGCAAGTTCTACCAGCTGGAGCGCCTGCTA[C/T]AGGTTWGCTCTTTGCTTTCTGAGTAGTGCTGCGCTACAGTATAGATTGCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19287
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088460 Splice Site, Nonsense 675 1043 16 26
ENSDART00000139523 None None 302 None 8
ENSDART00000145769 Splice Site, Nonsense 105 475 3 13
ENSDART00000088460 Splice Site, Nonsense 675 1043 16 26
ENSDART00000139523 None None 302 None 8
ENSDART00000145769 Splice Site, Nonsense 105 475 3 13

The following transcripts of ENSDARG00000061757 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 17629515)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17380450
GRCz11 22 17405428
KASP Assay ID:
2261-6685.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAACTTTGAAGATCTTCATTGCAAGTTCTACCAGCTGGAGCGCCTGCTA[C/T]AGGTTTGCTCTTTGCTTTCTGAGTAGTGCTGCGCTACAGTATAGATTGCT
Associated Phenotype:
Not determined