Busch Lab

ZMP

si:ch73-92i20.3

Ensembl ID:
ENSDARG00000061746
ZFIN ID:
ZDB-GENE-070705-271
Human Orthologue:
ARHGEF9
Human Description:
Cdc42 guanine nucleotide exchange factor (GEF) 9 [Source:HGNC Symbol;Acc:14561]
Mouse Orthologue:
Arhgef9
Mouse Description:
CDC42 guanine nucleotide exchange factor (GEF) 9 Gene [Source:MGI Symbol;Acc:MGI:2442233]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa5740 Nonsense F2 line generated Not yet available
sa2229 Nonsense F2 line generated Not yet available
sa9176 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa17928 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3556
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088408 Nonsense 38 521 1 10
ENSDART00000134393 Nonsense 41 251 2 5
ENSDART00000143878 Nonsense 41 549 2 11

The following transcripts of ENSDARG00000061746 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 23754097)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 21466969
GRCz11 5 21970769
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCGGGAGCTGGCCTTCAAGGCCGGTGATGTCATCAAGGTGTTGGACGCCT[C/A]GAATAAGGACTGGTGGTGGGGTCAAATCGACGAGGAGGAGGGCTGGTTTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26452
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088408 Nonsense 139 521 3 10
ENSDART00000134393 Nonsense 142 251 4 5
ENSDART00000143878 Nonsense 170 549 5 11

The following transcripts of ENSDARG00000061746 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 23735632)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 21448504
GRCz11 5 21952304
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTTTAGTTTAAATCTGTGTTTATGTTTCAGGGGTATCTTCGCCAGTGT[A/T]AAAAGCGAAGAGACATGTTCAACGACGATCAGCTGAAAGTGATCTTCGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5740
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088408 Nonsense 149 521 3 10
ENSDART00000134393 Nonsense 152 251 4 5
ENSDART00000143878 Nonsense 180 549 5 11
ENSDART00000088408 Nonsense 149 521 3 10
ENSDART00000134393 Nonsense 152 251 4 5
ENSDART00000143878 Nonsense 180 549 5 11

The following transcripts of ENSDARG00000061746 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 23735602)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 21448474
GRCz11 5 21952274
KASP Assay ID:
554-2900.1 (used for ordering genotyping assays)
KASP Sequence:
AGGGGTATCTTCGCCAGTGTAAAAAGCGAAGAGACATGTTCAACGACGAT[C/T]AGCTGAAAGTGATCTTCGGAAATATAGAAGACATTTACAGATTCCARCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2229
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088408 Nonsense 149 521 3 10
ENSDART00000134393 Nonsense 152 251 4 5
ENSDART00000143878 Nonsense 180 549 5 11
ENSDART00000088408 Nonsense 149 521 3 10
ENSDART00000134393 Nonsense 152 251 4 5
ENSDART00000143878 Nonsense 180 549 5 11

The following transcripts of ENSDARG00000061746 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 23735602)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 21448474
GRCz11 5 21952274
KASP Assay ID:
554-2900.1 (used for ordering genotyping assays)
KASP Sequence:
AGGGGTATCTTCGCCAGTGTAAAAAGCGAAGAGACATGTTCAACGACGAT[C/T]AGCTGAAAGTGATCTTCGGAAATATAGAAGACATTTACAGATTCCARCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9176
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088408 Essential Splice Site 313 521 5 10
ENSDART00000134393 None None 251 None 5
ENSDART00000143878 Essential Splice Site 344 549 7 11

The following transcripts of ENSDARG00000061746 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 23734862)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 21447734
GRCz11 5 21951534
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGAACATCGACAAAATYGCYCAAWGGCAGGCCTCTRTGCTGGACTGGGAG[G/A]TGGGTGGCTGAAGSTTTTCATGCAAAGTTYATTAGTTGGRTGGAAAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17928
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088408 Nonsense 421 521 7 10
ENSDART00000134393 None None 251 None 5
ENSDART00000143878 Nonsense 452 549 9 11

The following transcripts of ENSDARG00000061746 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 23726615)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 21439487
GRCz11 5 21943287
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAYGAGATCCATCTGTTCCTGCCCAAAAAGCTRGAGGAGAAAATCCGTTG[G/A]CTTCGGGCATTTCAAGAGGAAAGAAAGATGGTCCAGGAAGAYGAAAAAAT
Associated Phenotype:
Not determined