Busch Lab

ZMP

clasrp

Ensembl ID:
ENSDARG00000061742
ZFIN ID:
ZDB-GENE-060503-837
Description:
splicing factor, arginine/serine-rich 16 [Source:RefSeq peptide;Acc:NP_001037794]
Human Orthologue:
CLASRP
Human Description:
CLK4-associating serine/arginine rich protein [Source:HGNC Symbol;Acc:17731]
Mouse Orthologue:
Clasrp
Mouse Description:
CLK4-associating serine/arginine rich protein Gene [Source:MGI Symbol;Acc:MGI:1855695]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa43146 Nonsense Mutation detected in F1 DNA Not yet available
sa15739 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43146
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088421 Nonsense 29 560 2 21
ENSDART00000088425 Nonsense 29 645 1 21
ENSDART00000127825 Nonsense 29 642 2 21
ENSDART00000148032 None None 122 None 7

The following transcripts of ENSDARG00000061742 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 34947235)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 36626391
GRCz11 18 36607399
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGAGGGATGATGGTGGACTACAAACGGCGTGGGGAAAGGCGAAGAGAGTA[C/G]TATGAAAAAATTGTAAGTCATGCTTTGTTTACTGAAAACAGTCTAACCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15739
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088421 Nonsense 269 560 10 21
ENSDART00000088425 Nonsense 269 645 9 21
ENSDART00000127825 Nonsense 269 642 10 21
ENSDART00000148032 None None 122 None 7

The following transcripts of ENSDARG00000061742 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 34957671)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 36636827
GRCz11 18 36617835
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TWGGTAATGTGTTGTTGTGTTTCCTTCAGGGCCGGCGGTCTCGCAGACAA[C/T]GAAGAGAGTTCAGAGAGAAGTATATGAAAGGCAGGCAGATCAGCCCACCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4763
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088421 Nonsense 555 560 16 21
ENSDART00000088425 None 556 645 16 21
ENSDART00000127825 None 553 642 16 21
ENSDART00000148032 None 33 122 2 7

The following transcripts of ENSDARG00000061742 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 34967126)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 36646282
GRCz11 18 36627290
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGATGACACCTCAAGAAAAACTCAAACTCCGCATGCAGAAGGCCCTGAA[C/T]AGGCAATGTGAGTTACTGATTCAGGCGTACTGCCYTTTTATAGTCTATTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7866
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088421 Splice Site None 560 17 21
ENSDART00000088425 Splice Site, Nonsense 578 645 17 21
ENSDART00000127825 Splice Site, Nonsense 575 642 17 21
ENSDART00000148032 Splice Site, Nonsense 55 122 3 7

The following transcripts of ENSDARG00000061742 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 34969684)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 36648840
GRCz11 18 36629848
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGGATAAGAAGGCGGCACAAGCTAAGATCCAGCAACAGGAGCACAAGCGA[C/T]AGGTAAAAGCGTGGGTGTACCTGTGGTATGTGGATGGGGGTAATAGAGGT
Associated Phenotype:
Not determined