Busch Lab

ZMP

itpr3

Ensembl ID:
ENSDARG00000061741
ZFIN ID:
ZDB-GENE-070605-1
Description:
inositol 1,4,5-triphosphate receptor, type 3 [Source:RefSeq peptide;Acc:NP_001121741]
Human Orthologue:
ITPR3
Human Description:
inositol 1,4,5-triphosphate receptor, type 3 [Source:HGNC Symbol;Acc:6182]
Mouse Orthologue:
Itpr3
Mouse Description:
inositol 1,4,5-triphosphate receptor 3 Gene [Source:MGI Symbol;Acc:MGI:96624]

Alleles

There are 18 alleles of this gene:

Allele Name Consequence Status Availability
sa41183 Nonsense Mutation detected in F1 DNA Not yet available
sa11400 Nonsense Available for shipment Available now
sa17468 Nonsense Available for shipment Available now
sa41184 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa21271 Essential Splice Site Available for shipment Available now
sa21272 Essential Splice Site Available for shipment Available now
sa21273 Nonsense Available for shipment Available now
sa14415 Nonsense Available for shipment Available now
sa21274 Splice Site, Nonsense Available for shipment Available now
sa13385 Nonsense Available for shipment Available now
sa41185 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa45319 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa41186 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa21275 Essential Splice Site Available for shipment Available now
sa15369 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41183
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088119 Nonsense 105 2656 4 59
ENSDART00000088133 Nonsense 102 226 6 8
ENSDART00000129359 Nonsense 102 232 6 7
ENSDART00000142836 None None 2293 None 48
ENSDART00000144488 Nonsense 102 332 4 10
Genomic Location (Zv9):
Chromosome 8 (position 21822788)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 21252685
GRCz11 8 21284770
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAATTGATTTGTTTATTCTTCTCCTACAAAAGCATGCAGCTAATTTGGAA[C/T]AAAAGCAGAATGATGCTGAGAACAAAAAGGTCCACGGCGATGTGGTTAAA
Long Flanking Sequence:
AATTTTGAGTCATTTGTGTTTCTCCGGTCTCACGAAAACATTGGTTTTGGTGTTTTTTGAAGCATAAACATGTTTTGAACTGTAGAAAGATTTACAATTATGCATTAATCAGCTAACATAAATGTTGTTTAATTTTTGTGTGTTGTTGTTTTTTTAAATGTAGACTGCCTCTTTAAGGTGTATCCCATGAACAGATATTCGGCTCAGAAACAGTTCTGGAAAGCCAAACAGGCCAAACATGAAAAGGATAAAATTGGAGACATGGTGCTTCTTCAGAAATTGCAGGCAAGTTTCAAATATTTCTATTCATTTTAGAGAATCATACTGAAAGTGTTTGTGGTTTTACTTTTATCACAGCTTTGAGCAAAGAGGAATCTGATGTATTTGATCGATGTATTCAGTTTAGGTGTTCATTGACATTTGTACCTTTGAGCTGTTTGCTGTTCTTTGTAATTGATTTGTTTATTCTTCTCCTACAAAAGCATGCAGCTAATTTGGAA[C/T]AAAAGCAGAATGATGCTGAGAACAAAAAGGTCCACGGCGATGTGGTTAAATACGGCAGCGTCATTCAGGTGAGAATTTGGATGTAGTAAAATTATGCCTTTTAATTTTTTTTATTTTATAGCCCCGTTTTTCCCCATTGTTTGCAAAATATGTTTTTCCCAGACTTGGAAACATTTCTTTAAGACACATCACTGCATTTAATATTCATAAAAACAAATAAAACCAGGAGTAAAGCTCAATTAAGCAGCAGTTCGTTCAAGATAATTAGACATTCACTACTGGGTGTCCACGTAGTCTTAAAAAGTTGATAAATCAATGTAGAAAAATTTAAAGCCCTTAAAAAGTATTTAAAAAGTGCTATTTTGCAGGGTATTCAATTTTATATTCTTTTTGAATATGCAATGTATGGTTGTATGCAAACGTTTGCTTGAATTTTATCTGTGAATATCAGGATGCTGTGTAGTTTATGAAATCAATAAAATCCTGCTAGATTTGACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11400
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088119 Nonsense 203 2656 6 59
ENSDART00000088133 None None 226 None 8
ENSDART00000129359 None None 232 None 7
ENSDART00000142836 None None 2293 None 48
ENSDART00000144488 Nonsense 200 332 6 10
Genomic Location (Zv9):
Chromosome 8 (position 21829893)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 21259790
GRCz11 8 21291875
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGATCCTGAATCCTGTGAATGCTGGACAGCCTCTCCATGCCAGCAGCTA[T/A]GAGCTTCCCGATCAYTCAGGGTGCAAAGAGGTTTGCGATRARTTAACGAG
Long Flanking Sequence:
AACTACTTTAAAGCAGGGCTAAAAATTTAGTCTTCAGCTGTATATGCAAAATGATTCTTCTTTTTTCTTTGGTTTGGATTAGTTTTGTTTTTAGTGTGCATATAAAATTGCATGCTTTTATAGTCATCACCTACAGTATGTACAAGTACATCAACATTCTTTGAAGTCATACATTTACACACCTAAATACCAACCATGGCCTATAGAAAGCACAACTACTGCATGCACAAAGCCCACGTAAACACTCAAGAGTTATAAAAAAAAGCATGCGAATCATCCTATTACACATTTAAACAGGTTTACCAAGCTAATCTGGGTTTAAATGTTTGTAGATTGCTTCTTCCTTGTGTAAACTGATAGGGATGTACATATTTGCTTTTCAGATATCTGCGGCCATGACACTCATATTGAATGGTTTGTAATCCATTGCAGGTGGTGGTTGGAGACAAAGTGATCCTGAATCCTGTGAATGCTGGACAGCCTCTCCATGCCAGCAGCTA[T/A]GAGCTTCCCGATCATTCAGGGTGCAAAGAGGTTTGCGATAAGTTAACGAGTTTACATTGCATTTGTCTGTCAACATGACTGTGAAGTAGATGTGTTTACCCATGGCTTAAAGCAAGATACTGCAGATGAATAGGGACAATAGGCTAACAAAATAATAAATTATGATAAATTAATAGTCATCTTGTACCCTCACAGCTAATTAATTACATGAAAAAGTTATCAATGTCAATGAAATATGCACTAGTTTGCACACATTTCTAGCACAAAAATGTCAACATGGGATGAAATTAGGTTCAAAATTCTTCTTTTTTTATGACATATTAGAGTGTAACACTCTGTCCTAACAACATGCGACATGATATTTAAGTTACAGCCTAATTACCTAAAAACCTAATTAATGAATATTAAATCTCATTAACATTATTTAATTATATGCTGAATAACTGATGTTATCGGTTGGCCACTAATCTAGTCACAGTTCTAATGTTCCTGTGTAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17468
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088119 Nonsense 395 2656 13 59
ENSDART00000088133 None None 226 None 8
ENSDART00000129359 None None 232 None 7
ENSDART00000142836 Nonsense 45 2293 2 48
ENSDART00000144488 None None 332 None 10
Genomic Location (Zv9):
Chromosome 8 (position 21835478)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 21265375
GRCz11 8 21297460
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTACCCCCTGTCTGTTTATCYTTTTCACYGCCTACAGAAATTCTTATGTT[C/T]GATTTCGYCACCTGTGCACRAACACTTGGATCCAAAGCACCAACATTCCT
Long Flanking Sequence:
TTACATGAATAAGCCTGCTCCCGACCAGGTTTGAGCTACCAGAACTGTTGCTATGACAATAACTCTTAGATGAGTTTTGAAGAACGAAATGATCCTGGATCATGTCAAATCGTCAACATCCTAATCCAGCTAACTGAGTAATTCACCTACAAAGAACAGACCCCAAGACTTTACTTTTTATGTTGTGAAAAGTTGTTTTTTCTGTCATGAATGTCTGATTGTTTCTTTGCCTACAGGTGGACAGCAGTCGTATCAAGAGAAGCCTTGGAGAAAGGATTAAATATAAGCTAGTCGCAGTGCCTCATGGGAACGACATCGCCTCTCTGTTTGAGCTGGACCCGACAACACTGCAGAAGACTGATTCATTTGTGCCAAGGTATTACGTTGTGTGCTTTTCTCTCCCTTTCTCTCGGTTTGACTGGCTGCATTCTGTGGGAAGAAGAACTTGATTTACCCCCTGTCTGTTTATCTTTTTCACTGCCTACAGAAATTCTTATGTT[C/T]GATTTCGCCACCTGTGCACGAACACTTGGATCCAAAGCACCAACATTCCTATCGACATCGATGAAGAGCGGCCGATTCGATTAATGGTGAAAAACTTTCCAACTATAATTTCACAGTTTCAACATTTCTGTATTTTGTAAATAGGACAAATTACAACGCTAACTATATGTTTTGCCACAACTTTTGTTTAATTGTTTATTTATAAAGTTGTATGTCACATTGTATTTCTGTTTATAATATAATATTATTAAAGATTTTGCTGGTCAATAAAATAAAAAAATTAAATGTATGAAACCTATGTAATCATGACATGACATAACACATAAATATGAAGGTTTTATGCATCCTTATGACTATTGACATTAGGTGTCATTTGCTAAGTTAAGTCATTTTAAATGCAAAGGTGACATTGTTTGAGATGTCTTTGTCATGACAAGTATGATGTATTTGGTTATTTGTCATGAAAACTTGACAACACCAAAACAACACAACTTGTCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41184
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088119 Essential Splice Site 423 2656 13 59
ENSDART00000088133 None None 226 None 8
ENSDART00000129359 None None 232 None 7
ENSDART00000142836 Essential Splice Site 73 2293 2 48
ENSDART00000144488 None None 332 None 10
Genomic Location (Zv9):
Chromosome 8 (position 21835565)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 21265462
GRCz11 8 21297547
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCACCAACATTCCTATCGACATCGATGAAGAGCGGCCGATTCGATTAATG[G/A]TGAAAAACTTTCCAACTATAATTTCACAGTTTCAACATTTCTGTATTTTG
Long Flanking Sequence:
AATGATCCTGGATCATGTCAAATCGTCAACATCCTAATCCAGCTAACTGAGTAATTCACCTACAAAGAACAGACCCCAAGACTTTACTTTTTATGTTGTGAAAAGTTGTTTTTTCTGTCATGAATGTCTGATTGTTTCTTTGCCTACAGGTGGACAGCAGTCGTATCAAGAGAAGCCTTGGAGAAAGGATTAAATATAAGCTAGTCGCAGTGCCTCATGGGAACGACATCGCCTCTCTGTTTGAGCTGGACCCGACAACACTGCAGAAGACTGATTCATTTGTGCCAAGGTATTACGTTGTGTGCTTTTCTCTCCCTTTCTCTCGGTTTGACTGGCTGCATTCTGTGGGAAGAAGAACTTGATTTACCCCCTGTCTGTTTATCTTTTTCACTGCCTACAGAAATTCTTATGTTCGATTTCGCCACCTGTGCACGAACACTTGGATCCAAAGCACCAACATTCCTATCGACATCGATGAAGAGCGGCCGATTCGATTAATG[G/A]TGAAAAACTTTCCAACTATAATTTCACAGTTTCAACATTTCTGTATTTTGTAAATAGGACAAATTACAACGCTAACTATATGTTTTGCCACAACTTTTGTTTAATTGTTTATTTATAAAGTTGTATGTCACATTGTATTTCTGTTTATAATATAATATTATTAAAGATTTTGCTGGTCAATAAAATAAAAAAATTAAATGTATGAAACCTATGTAATCATGACATGACATAACACATAAATATGAAGGTTTTATGCATCCTTATGACTATTGACATTAGGTGTCATTTGCTAAGTTAAGTCATTTTAAATGCAAAGGTGACATTGTTTGAGATGTCTTTGTCATGACAAGTATGATGTATTTGGTTATTTGTCATGAAAACTTGACAACACCAAAACAACACAACTTGTCATAAATCTGTCATAAACTTGATTGTTATGAGGCCATTTTAATTATCATGAATATTGTAACAATTTTATAATTTCATAACAAATTGAATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21271
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088119 Essential Splice Site 524 2656 15 59
ENSDART00000088133 None None 226 None 8
ENSDART00000129359 None None 232 None 7
ENSDART00000142836 Essential Splice Site 174 2293 4 48
ENSDART00000144488 None None 332 None 10
Genomic Location (Zv9):
Chromosome 8 (position 21838507)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 21268404
GRCz11 8 21300489
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAACCGAGAGAGACAGAAACTGATGAGAGAGCAGAACATTTTAAAACAG[G/T]TCGGATTTTTTTTTAATAATTTACAAGTTTGCCCGTTGAAACGTCTTGTT
Long Flanking Sequence:
AACATTATTTAACTCAAATAATGTAATTAAAATGATTGTTAAATTATTGCGTGTGCAGTATTTTAATATTTATTCTATGTCTCCTGGTAGCTGGGCACGTGCCCCACTAAAGAGGACAAAGAAGCATTCGCCATCGTCTCTGTGCCGGTCATGGAGATTCGAGATCTAGACTTCGCCAATGATGCGAGTCTCATGTTGAGCACTGTTGTCGAGAAGTTCAAATACGGTTTTCTCAGTCCTAATGACAGAAGGTACAGTAGAGTTGACACGAGTCCCTGATTTAATCCTTTGTTCTGAGACAACTGAGGATTTACTTTGTAAACAGTTGTAATGTAGACATATTGCCATGTATGCTCAGGTATGCCATTAAGCTGCTGGAGGATGTGGTATTCTTTGTTGTGGATCAACTTAACAATGGCCAGCCGGCCCTGGAGGTGTCGATGAACAAGCCCAACCGAGAGAGACAGAAACTGATGAGAGAGCAGAACATTTTAAAACAG[G/T]TCGGATTTTTTTTTAATAATTTACAAGTTTGCCCGTTGAAACGTCTTGTTTGGTGAAGCTTGGCTTATTGTGCTGTTTTCTGCTTAGATATTTGGGATCATTAAAGCTCCGTTCAAAGAGAGGGGAGATGATCCTCCTCTACTGACACTGGAGGAACTGTCCGACCAGAAATACTTATTGTATCAGTACATGCTCAGGCTGTGCTACAGGGTGCTGCGTCATTCACAGGAAGACTACCGAAAGAATCAGGTACTCCAGTTCACAACCACACAGGTGCCTACGGGTGCTGTGTGTCACCGTGTGGCATCGTTTTGACTTTTGAGGCTTAACAATTCCATAATATGTTAGTAGATATTTAGGAAACATGCAAAGTTCATATCTGTCTTTCTGATGAGACGATAAACTGAGGTCCTGACTCTCTGTGGTCATTAAAATTTCCATGGCACTTCTCGTAAAGAGTAGAGGTGTAATCTCGGTGTCCTGGCCCAATTCTCTTCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21272
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088119 Essential Splice Site 821 2656 21 59
ENSDART00000088133 None None 226 None 8
ENSDART00000129359 None None 232 None 7
ENSDART00000142836 Essential Splice Site 471 2293 10 48
ENSDART00000144488 None None 332 None 10
Genomic Location (Zv9):
Chromosome 8 (position 21845951)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 21275848
GRCz11 8 21307933
KASP Assay ID:
2260-0491.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACTATTTAAACAATCAAAGGTGTAATAATGTTTGCTGTTTTATGTTATA[G/A]TTATGACTCTCACTTGGACTATTCACGAGACAATAAAAAGAACAAGTTTG
Long Flanking Sequence:
TTACTGTACAAACTGCATTGTACATAAATCAGATGAACATTTTCATATCAGTCAATAATATTACTGCAATTAATTAAAAAAACTGACTAAATATATATTTACACACATTTACTGAAGTAAACAAACAGAGGTAATGATGGGCTAGAAATCTGCGGATTCCGTGTGGGCCTACTTAAAGGATAACACAAAACACCACAAGAAGGCAGGACAAAGAAAACAACACATGCAATTTGTAACAAAAATAAATTAATTAACTTTAGTCGTAACACTACCCAATATCTTAATATAATTATTGATCTAATATCTATTAATAAGCAGCAAATTATGAGTTTATTGAGATAAATATGATTTAACTGTGAGAACTGTACCTAATAAAGTGTAACCAAACAAAATTACTGAATGATCTAACATCTAACAAACATTAAACATTTTTACATGGCAGTAAAGAGTGACTATTTAAACAATCAAAGGTGTAATAATGTTTGCTGTTTTATGTTATA[G/A]TTATGACTCTCACTTGGACTATTCACGAGACAATAAAAAGAACAAGTTTGCTAATACCATGGCTTTCATGGAGGAATACCTCAACAATGTGCTCATCGATGACCTGCCTTTTGCAAACGAGGAGAAAAACAAGCTAACGTATGAGGTACTGTGGCATATTATTATGCTTTAGCTCCACTGGTAGTGCTTGGGAGTATTTATGGCTGCATACTTAAGCGTTGAATAAAACCATCTGTAAGATATTTCCAAATCATCTTCACATTTTTGCTTCATTTGCATGTTTGTAGGTGGTGAGCTTGGCGAGGCATCTCATCTACTTTGGCTTCTACAGCTTTTTCGAGCTCCTGAGATTGACTCGCACTCTTCTGGGAATCATAGACTGCACTCCGAGCAACGCTTCCATCAACCCACTGTTCAACGATGATGGCAGTGGTCAGTACTGAATAATGTTTAGATGTTTACATGGCTCCAAACCCGCTACTGAAATGGATGCAAAAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21273
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088119 Nonsense 868 2656 21 59
ENSDART00000088133 None None 226 None 8
ENSDART00000129359 None None 232 None 7
ENSDART00000142836 Nonsense 518 2293 10 48
ENSDART00000144488 None None 332 None 10
Genomic Location (Zv9):
Chromosome 8 (position 21846093)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 21275990
GRCz11 8 21308075
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCATCGATGACCTGCCTTTTGCAAACGAGGAGAAAAACAAGCTAACGTA[T/A]GAGGTACTGTGGCATATTATTATGCTTTAGCTCCACTGGTAGTGCTTGGG
Long Flanking Sequence:
TAGAAATCTGCGGATTCCGTGTGGGCCTACTTAAAGGATAACACAAAACACCACAAGAAGGCAGGACAAAGAAAACAACACATGCAATTTGTAACAAAAATAAATTAATTAACTTTAGTCGTAACACTACCCAATATCTTAATATAATTATTGATCTAATATCTATTAATAAGCAGCAAATTATGAGTTTATTGAGATAAATATGATTTAACTGTGAGAACTGTACCTAATAAAGTGTAACCAAACAAAATTACTGAATGATCTAACATCTAACAAACATTAAACATTTTTACATGGCAGTAAAGAGTGACTATTTAAACAATCAAAGGTGTAATAATGTTTGCTGTTTTATGTTATAGTTATGACTCTCACTTGGACTATTCACGAGACAATAAAAAGAACAAGTTTGCTAATACCATGGCTTTCATGGAGGAATACCTCAACAATGTGCTCATCGATGACCTGCCTTTTGCAAACGAGGAGAAAAACAAGCTAACGTA[T/A]GAGGTACTGTGGCATATTATTATGCTTTAGCTCCACTGGTAGTGCTTGGGAGTATTTATGGCTGCATACTTAAGCGTTGAATAAAACCATCTGTAAGATATTTCCAAATCATCTTCACATTTTTGCTTCATTTGCATGTTTGTAGGTGGTGAGCTTGGCGAGGCATCTCATCTACTTTGGCTTCTACAGCTTTTTCGAGCTCCTGAGATTGACTCGCACTCTTCTGGGAATCATAGACTGCACTCCGAGCAACGCTTCCATCAACCCACTGTTCAACGATGATGGCAGTGGTCAGTACTGAATAATGTTTAGATGTTTACATGGCTCCAAACCCGCTACTGAAATGGATGCAAAAGTTATTTTTTAAGGCAAAAAATGATGACTATCACACATTTTATAATGTTTTACAGATGAAACCTACCAAATGAAATAAAGTGTAACAATAGTTATATACCAAATACTCAAATCTAGTCACAAAAATCATTTAATGACATTAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14415
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088119 Nonsense 964 2656 23 59
ENSDART00000088133 None None 226 None 8
ENSDART00000129359 None None 232 None 7
ENSDART00000142836 Nonsense 613 2293 12 48
ENSDART00000144488 None None 332 None 10
Genomic Location (Zv9):
Chromosome 8 (position 21847842)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 21277739
GRCz11 8 21309824
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGGWCGAWCTGGAGACAGTCAAGTCGGCAGTAAAGACAGCATCGAYACA[C/T]AAGACATCACTGTCATGGACACCAAACTCAARATTCTGGAGATTTTACAG
Long Flanking Sequence:
AAAATAATGATTTAAAGTTCACATTTAATGAGCAATTGTGTAATTTGTGTACTTGAATAAAAGGCTAAAAAAGTCAATAAAATTATTTTTTAATAACTTTAATTACTTACATCTTTTTTTACATATTTGTTCTGGTGTGTGTAATAAAAAAACTTCTACATATTTTTTTGTTTTCATTCTATACTAACAAAAATAAAAAGTAATGTAAAAATAAAATGTGCGACACAGAGGGAAACCCTTTATTTCTCAATTAGCTCACTGTTTGTTTTAGTCTGGTATTTGTATATACTTATATAAACTAAAACATCCTAGAATTTCAGTCTCCAAAATGGCCAGTAAATTGATTGAATCATTAATTTTTAGGTAAGAACGTCAGGCGCTCCATTCATGGCATGGGACAGATGATGTCTACCATGGTGCTTAACCGAAAACCATCTCTGTTCTCCGCTCCTGGTCGAACTGGAGACAGTCAAGTCGGCAGTAAAGACAGCATCGACACA[C/T]AAGACATCACTGTCATGGACACCAAACTCAAGATTCTGGAGATTTTACAGGTAGTGTGTTCAAGTTATCTTTATTTCTATAGCACTTTATAAAATGTAGATTACAGTATATCAAAGCCACTTTACAAGAAGATGGCAACATTTTATTATTGTGGAACATATTTATTGCTGATGGTAGAAGAATAGTAGTAGACTGCTGCTCTAGTTCCATTAAAAAAAAAAAAAAACAGTTCAGTTTAATACGAATGAAGATACACTCAGGGGTAATGAAAAATTGTAAAATGTAAAAAAAGTCAAAAAATTTTTTACTAACATTAATGAAATAGTTTACCCTAAGTGAAAATTATCACATAATTTTTTCTTCCCAAAGCCATACTCTGTGTTTATGACTGTTCTTTCGGACAAACACAGTTGTTATAATTCACATATTTTCTTTGCTGTAAAATTGTGTTGGGTAGTGGGTCTTTTTTGAAACTTCCAAAAGCACATAAATCCATCGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21274
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088119 Splice Site, Nonsense 1097 2656 26 59
ENSDART00000088133 None None 226 None 8
ENSDART00000129359 None None 232 None 7
ENSDART00000142836 Splice Site, Nonsense 741 2293 15 48
ENSDART00000144488 None None 332 None 10
Genomic Location (Zv9):
Chromosome 8 (position 21852233)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 21282130
GRCz11 8 21314215
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTGTTCAAGCACTTCAGTCAAAGACAAGAAGTCCTTCATACTTTTAAA[C/T]AGGTAAAAAAGCTGTGCCTAAATAGTTCAGATCAAACATCTGTAGGTAAA
Long Flanking Sequence:
TTAAATGTCACTTTAAGCTGTATAGAAGTGTCTTGAAAAATATCTAGTCAAATATTATTTATTGTCATCATCGCTAAGATAAAATAAATCATTTATTAGAAATGAGTTATTAAAACTATTATGATTAGAAATGTGCTGAAAAAAATCTTCTCTCCGTTAAACAGAAATTGTGGAAATAAGTAAACAGAGGGGCTAATAATTCAGGGGGGCTAATATTTCTGACTTCAACTGTATATTAATTATTGAAATAAAAAAAGTCCCAAAAAATGTGAAATATTACTATTGCGCATGATCACTCACAACATTGTATAACCTCTGCCCTTTCCTCGCTGTACAGTAAAGGAAACAGCATTCTGGAAGTGGATGATGAAGGAGGACGAATGTTTCTGCGTGTTTTGATCCACCTCATCATGCACGACTACCCTCCATTGGTTTCTGGGGCCTTGCAGTTGCTGTTCAAGCACTTCAGTCAAAGACAAGAAGTCCTTCATACTTTTAAA[C/T]AGGTAAAAAAGCTGTGCCTAAATAGTTCAGATCAAACATCTGTAGGTAAAGAACATTTCGAGATGTGCAAAATGGAGATTTAAAGGGATCGTTTACCCAACAAGGTAAATTCTGTCATTACTTACTTTAACGTTTTTACTTAAACTTAAACATTTTCTTTCCTCTGTTAAAGACAAAAACATATTTTGAATAATGCTGAAAACCTGTAACCATTGACTGCCAGAGAAAGTTTTTTTTCAATGGTTACAATTTTCCAGCTTTCTTCATAATGTCTTCTTTAGAGTTCAACAAAAGAATAAAAACACTTTTAGAACCAATTGAGGGTTAGTAAATAGGGAGCATATTTGAATTTTTTGGGTAAAATATCCCTTTAAGGAACGCTAACATTATGGGATCTGTTTTAACAATCTAGGCGCAAAACGCAGGGCGCAAAAAGCATTAAAGGCATGTCTGAGTCCACTTTTGCATCATGGTGCATTTGCAATTTACATGGCAGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13385
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088119 Nonsense 1110 2656 27 59
ENSDART00000088133 None None 226 None 8
ENSDART00000129359 None None 232 None 7
ENSDART00000142836 Nonsense 754 2293 16 48
ENSDART00000144488 None None 332 None 10
Genomic Location (Zv9):
Chromosome 8 (position 21853548)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 21283445
GRCz11 8 21315530
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTTCTTTTCAGGTCCAATTGCTTATTTCAACTCAGGATGTGGACAACTA[T/A]AAACACATAAAACGAGATYTGGATCTGCTGCGCACCATGGTGGAGAAGTC
Long Flanking Sequence:
AAACGAATAAATGAATAATAATAACAAAGTGTGGTCAAAAAACTGAGTTATATTCAAACACACATGCTATGCCCCATATGGTCCAAAACCTGACAGGTGGACAAATCTAAGCTTGTTTTTAATAAAACAAATATAAATATGGATAAAATGGATTAAAAATGGATTTGTTTATTGTTTTTTAAATAACATGATGGAAAATGGGAAAATTAGTGTTGCATTGGTCTGAAAATAGCAACACGTCGGGGCAAACAGGTCCTGCACCTTATTGTGCCAGGTGTATGATATGGTCCAACATTTGACTTAAAAAACTAATAAAACATAACTAGCTTTAAAAATCTGACATTCTTGCTCATCCTTATGCAGCAAATTACAATTCTGGTACCACGAAAATAGAAAATGCTAAAATGCAGGCCTTTTTAGATTAAAAACCATGTCTTTCATTCTGCTGTTTGTTCTTTTCAGGTCCAATTGCTTATTTCAACTCAGGATGTGGACAACTA[T/A]AAACACATAAAACGAGATCTGGATCTGCTGCGCACCATGGTGGAGAAGTCTGAGCTTTGGGTCATTAAAAAGAGCAGTTCTGGGGGAGATGGAAAGAAAGACAAGAAAGACAAAAAAGAGCCTGAAGCGGTGCGTCATACACTGAGGCATGTGTATTAATGTGATTAAACATGTGAAAAGAATGTTACTTATTTTTTTTCTTTTATGCAGGTGTCACCTGAGGAGGAGGCTGATTCTAAGAAACAGACAACTGAAAAAAGCAATGAAAGCTACCAGAATGTTAAAGAGGTGATGTTTCAGCATGTGTTCTCAGACTATATAGTTATTATACTGGAGTCCAAAATGTCTAAGATGTTTAGTTACATTACTGTTTAAAAGGTTGAATCTGTAAGTGTTTATTTTAAATATTTATTTTTATATTTGTTTAGCAATAATGCATTCATCAAGCCTAATTAATGCATAGTTCTTTAAAAAAGGAAAATGATTGATAAATGAAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41185
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088119 Essential Splice Site 1219 2656 29 59
ENSDART00000088133 None None 226 None 8
ENSDART00000129359 None None 232 None 7
ENSDART00000142836 Essential Splice Site 863 2293 18 48
ENSDART00000144488 None None 332 None 10
Genomic Location (Zv9):
Chromosome 8 (position 21854737)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 21284634
GRCz11 8 21316719
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGTGCGCACAAAGTTATGCTGGACCTGTTGCAGATCTCCTATGATCGGG[T/C]TTGTGGCCTTTTAAAGCATTCAAAACTCTACTAGATGTTTTGTAGCAAGT
Long Flanking Sequence:
AGAAATAAATTAAAAAGGTTAGAACCACTTGAGTAAGAGGAAAATGTATTTTTGGGTGAAATATTCCTTAAATAGTAAAGAAAAGTATGTTAAAAAGTAATTTTAGATGATTTCTTTTCAGATAAATGTTTATTGATCCTTTCTACCCATTATTATATCCATTATTCTAATAATAATAACTGAAGTTAAATAAGAATCTCTCAGAATTTTTCTTTAAGTGTAACATTCAGTCATGAACCTTATTTTTCTATAAAGGACCGCAAGTAAATAACTGCAGTTGTGAATAAAAATAAAAACAAAGCTGTTAACTTTACTGTTTTGATTTTCTTTTTTTGCAAATAAGCTAACCAACATTTTAAATCTGACTTCTGACCTTTAGATTCTAGAGCGATTGAATAAAATGTGCAGTTCAGGTGTATTTAAGAAGCAACAAAGGCTACTGAAGAACATGGGTGCGCACAAAGTTATGCTGGACCTGTTGCAGATCTCCTATGATCGGG[T/C]TTGTGGCCTTTTAAAGCATTCAAAACTCTACTAGATGTTTTGTAGCAAGTTTTTGGATTTGTCCCCCTATCAGCTCATGTTTTTTTCTCTTTTTAGAATGACACCAAAATGCTGGAGATCATCAAGTACACACATCTGTTTCTGCAAAAGTTCTGCACAGGGAATCTGGAGAACCAGGCTCTCCTCCATAAACACCTCAACCTTTTCCTGACACCTAGGGTCAGTTCAAAGCATAGAGGATGAAATACATTAGTATAGCATACTTGGCAGATTAGTGTGAAGACCGAACAAGTGGAGTGAGAACTGAACTACAAGTGTGAACATACACTAAGATGTCCTTGTATACTTTGATTGTGTTCTCACTTCTCTTTTTGTTTTCTCTCCCAGCTCCTGGAGGCAGAAACAATGCAGCAGATTTTCAGCAATAATTTCCAGCTCTGTTCTGAGATCAGCGAGTCTGTGCTGCATCATTTCATACATTGCCTGGCCACACAAGGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45319
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088119 Essential Splice Site 1496 2656 35 59
ENSDART00000088133 None None 226 None 8
ENSDART00000129359 None None 232 None 7
ENSDART00000142836 Essential Splice Site 1140 2293 24 48
ENSDART00000144488 None None 332 None 10
Genomic Location (Zv9):
Chromosome 8 (position 21860172)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 21290069
GRCz11 8 21322154
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTCATTTAATTCTCCTAATTTTCTCCTCATTATTCTTTTGTCTCGTTC[A/T]GGCTCATCACACCACTGTAAAGCAGCTGCTGCAGTCCACCATGCGTCTGT
Long Flanking Sequence:
GGAAATATTTGTTTCTATTTGATAAGAATGGCTTGTTTAGCTAAAAGAGTAGAAAAAGCAACAACCTGGCGAGATGCAACAAGTCAACAAGTCAATCTCTCTGAAATGCCAAAAAGGGCTGTCAGGGGTTAGGGTCCAGATTTATTTAATATGTTCATTTAGTGTATCAAAAACAGTGGACCAGAAATTTGTCAATTTAGGGCAACTCCTGAACATATGGATATGGTTAGCAGCATTTTCTGCCACCTTTGATAAGTTGCATCATTGATGAATTTAAGTAAGTGTTTAAAAAAAAACGAACCCCAATCTTTTCAAAGGTTGAGTTAGCTTTAAATAAATTCTGTGTCTTTACTAGAAGAATAATAAAATAAATATGATTGCTGTTTGATATTTACAGTACCATGTCTCATATATCACATAAATGTTTTTTTTTATTTATTATTTGATCAGTTCTCATTTAATTCTCCTAATTTTCTCCTCATTATTCTTTTGTCTCGTTC[A/T]GGCTCATCACACCACTGTAAAGCAGCTGCTGCAGTCCACCATGCGTCTGTTAGACTGTCCATGGCTACAGCCACAGCAAAAAGTCCAAGTGGAGTCCTGCATCCGAACACTAGCAGTGACAAGTAGGTCATCCTAATAGATAAAGAGGAAAAATGAGGATTAATGTGTCTTTATCAGTTTTCATGGACATAAAAGATTTCTGCTGCATGACCAAATTTATTTTTTTTTTTTTCTGACTGTCCACAAAGCCAAGAGTCGCTCTATTCCTCTGCCAGTGGAGTTGGAGGCTCATGTCAACATGATGTTGAGTCACAGTAATTCCCTCACATTGTCCCGATCCAGTCACTCCAACAAAAGCATGTCACGCTTAACACGGCCTGCCGCTCCCACCAACCCCTGGGACTACAAGAACATCATTGAAAAACTACAGGTATTTAAGAGTGTGTGGTATAAATAGAAGCATTATACATATTTAAACTCATTTAAATTTTGGAGTCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41186
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088119 Essential Splice Site 1649 2656 38 59
ENSDART00000088133 None None 226 None 8
ENSDART00000129359 None None 232 None 7
ENSDART00000142836 Essential Splice Site 1290 2293 27 48
ENSDART00000144488 None None 332 None 10
Genomic Location (Zv9):
Chromosome 8 (position 21862502)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 21292399
GRCz11 8 21324484
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGCAAAGCGATTATGTGTGACTTCATGTTTTTCTCCTTTTGCTCTGAGC[A/T]GATTGATCCAGCACACAAAGGCCCTCATGAACTCCGATGAGAAGCTCTGT
Long Flanking Sequence:
AAAGTTGGGCCTGTTAACATTAGTTAATGCACCGTGGGTTAACACGAACTAACAATGAACTAATGTTTTTTAACACTAACGTTAACAAAGATTAAAAAATAACATCATAAATATTACTAATTGGTTGTTCATGTTTGTAAATGCATAACTAGTATTATTAATGGACTGTTGTTTTAAAAGTGTTTAGATGTATAGTATTGCAGTGTATGAGAGTTTGTGTAACTGCTCTTAGGATATCATTAACACACTGGAGGAGCGTGTGATGCCTTTGGTGAATGCGGAGCTGTCTGTGCTGGTGGATGTGCTGCATCAGCCTGAGCTGCTGTTTCTGGAAGGCACCGATGCTCGCTCACGCTGTGAATCAGGAGGATTTATTTCTAAGTGAGTCGCTTTTGTGTCACTTTTGACTTTTCTCATTTTGCTTTCGGCACACATGTCTTAGTCAAAAAAAAGCAAAGCGATTATGTGTGACTTCATGTTTTTCTCCTTTTGCTCTGAGC[A/T]GATTGATCCAGCACACAAAGGCCCTCATGAACTCCGATGAGAAGCTCTGTATCAAAGTCCTCAGAACTCTGCAGGAAATGCTCATTCGCGAGTTGGATTTCGATGAAAAGGTGAGGTTGAATCACAATAGTAAGTGGTAAAAGGCATTATAAATATTAAGCGTTTTGAAATTTGTTATGTAAGATTAATCTCATGGATGCACTGGGACATATCCTCAGTGATGTATTCTGGGATCATTGGGTGTTGCGGCAATCTAAATAATAATTGTTTTGAAATTTGTAAAGTACAGCATTTTAAAATTTCCTAAACTAATTTTAGTTTAACTTAATATTCAGAAAGTATATTCTAAATATTGAATATAATGATACATATATTAGAATATAAGTTACTGTATAGTCAAAGATGAGACATCCATTTTAGTGTCTACTTCAAACTTACAAAAGGGATTTTATATGGAAACCTTTATATAAACATTTCAAGTGTCTACTTAAGTAACTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21275
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088119 None 1828 2656 41 59
ENSDART00000088133 None None 226 None 8
ENSDART00000129359 None None 232 None 7
ENSDART00000142836 Essential Splice Site 1469 2293 None 48
ENSDART00000144488 None None 332 None 10
Genomic Location (Zv9):
Chromosome 8 (position 21865265)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 21295162
GRCz11 8 21327247
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGGGGGAAATGAGCAACAAAGCCAAAGATGACAAAGATCTGGAGACTGG[T/A]AATGCAACCCCACACTTGCTTCCTCTGTAAGGGACACTCCACTTTTTTTG
Long Flanking Sequence:
ATGCTAAATTGATACTGCAGAATTATTAAGATACAATTCACAAGCAAGACTCCTGACTTATGTTTGTTAAGGTGCAGAGGGCGAGAGAGACTGGCTAACAGTGGCAGCATTACAGTGTCGCCTGGACAAAGAAGGCGGCACCAAACTCTTCACAGACCTCATCACCAGCACCAAGAATGAGAAGATCTTCCAGGAGAGCATTCAGCTCGCTATCTGTCTGCTAGAAGGGGGAAACACAGAGATCCAGGTGGAGGAATAGCTTCTGTGCTAATAGAGCTAGCAGGAGGATCAGTACATTATGCATTATTATGATTATATTACTCATCTTTATAACAGAACTCCTTCTACAAACTCATGATGGGAGACAACAAGTCTGAGAAGTTTTTTAAAGTGCTGAATGACCGCATGAAGAACGCACAGCTTGACATCAAATCCACCGTCTCTGTCAATGTGGGGGAAATGAGCAACAAAGCCAAAGATGACAAAGATCTGGAGACTGG[T/A]AATGCAACCCCACACTTGCTTCCTCTGTAAGGGACACTCCACTTTTTTTGAAAATAGACTCAATTTGCAGGTTGAGTTTAACCATTTTTAAATCCCTTTAAACTGATCTCCAGGTCTGGCAGGGATACTTTTAGCTTAGCTTAGCATAGATCATTGAATCAGATTAGACCATTAGCAGCCCATTCAAAAATGTCGAAAGGGTTCAATAATTTCCCATTTAAAGTTTGACACTTCTATAGTTAAATCGTGTACTAAAAACAATAATGAACAGTTGTTATTTTCTAGACTGATACATGTAGGAACTTTACTCTCATTCTAGCGTAATAATAATTTTCCTTCAGGTGGCGTATCGTCGTTTGGCCAGCCTGAGCCTCAACCTGAACAACAGGAAGTGGAAACAGAAATGGGGCCATCTGTCACCATCATGAAACCCATCCTGCGCTTTCTACAGCTGCTCTGTGAGAACCACAATCAGGACCTTCAGGTCTGAACAACCCCAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27182
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088119 Nonsense 2032 2656 46 59
ENSDART00000088133 None None 226 None 8
ENSDART00000129359 None None 232 None 7
ENSDART00000142836 Nonsense 1660 2293 35 48
ENSDART00000144488 None None 332 None 10
Genomic Location (Zv9):
Chromosome 8 (position 21868584)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 21298481
GRCz11 8 21330566
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAACAGTTCTGTGCTGTATGTCTTTAGGTGGAGCTGATTAAAAAGGCTTA[T/A]CTGCAAGAGGGTGAGTGTAAGGAGGGAGAAGTGTCACCACGAGAAGTTGG
Long Flanking Sequence:
TATTATGTTTTTAAACTCTTTAACTCTTTTCACATGTGGTGTCTTGCTTAAAACACACACAAAAAAAAAAACTGTAATTATATAACAAAACTTTTTTTTTAACAAAACTCTTTTTACAGACATGCATTGTCTCCCATGAGTGCAACGGTATTGACATCATCACAGCTTTAATTCTGAATGACATCAGTCCTTTATGTCGATATCGCATGGAACTGGTGCTTCAGCTCAAGGTGAGGATAAAGTCAAAGCTTTATTTTAATAATTGATAATGACTTAATGTAACAAACATGAATGTTATCAGGACAATGCCTCTAAGCTTCTTCTGGCTCTGATGGAGAGCCGTCATGACAGTGAGAATGCAGAGAGGATCCTGTTTAATCTTCGACCCAGAGAACTGGTCAGTTTGACTGCATCATGTTTGTCTGCATGTAAAGTATAATGGTAGTATTTTAACAGTTCTGTGCTGTATGTCTTTAGGTGGAGCTGATTAAAAAGGCTTA[T/A]CTGCAAGAGGGTGAGTGTAAGGAGGGAGAAGTGTCACCACGAGAAGTTGGGCATAACATCTACATCCTGGCACTACAGGTGAAGCACTACATCAGATTGGCATGTTTGATGCCACTGCTGATTTTTTTGATTGAGTGATATGCAGAGCCAATGGACTATACTGTATGCACAGCTAGTGTTTTTCAGCCAATGATGAACTTCTGGTAAAAGCTTTATGTGAATATTTTCATTTTTTTAAGGTTTCTTTTACAGTATCGATGTTGTAATGTAATTCAGATATAATCATTTAAATAATGTTAAGCATTCGTTTGGTTGTTAAAGCGTGAAAAGAGATGAAAGAGCGTTTAAGCGCAGGGACCGTCATTAGCAGCATGCTAGCGCAGAAATTCTATTGAAAATACTGAGGTAAAACTTAAACTTAATTCCATATTTTAAAGACATGGCACAGAAAAATAATTTAAAACAGTGCTTCTTGTTTGATCTGAAACCCACTTTAAAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1770
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088119 Missense 2076 2656 47 59
ENSDART00000088133 None None 226 None 8
ENSDART00000129359 None None 232 None 7
ENSDART00000142836 Missense 1704 2293 36 48
ENSDART00000144488 None None 332 None 10
Genomic Location (Zv9):
Chromosome 8 (position 21869825)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 21299722
GRCz11 8 21331807
KASP Assay ID:
554-1763.1 (used for ordering genotyping assays)
KASP Sequence:
TGCCCGACACAACAAAGTGCTACTCACACTGCTTAAACCAGTAAAGAAGA[T/G]AAAAGAGGAAGAAGAGGAAAGCATCTCCTCTATGGTAACTTRCGACTTTG
Long Flanking Sequence:
TTTTTTTTTCTTCAGGTGTTTTTTTATTTGCTCACCAATGCATTTTTAATCAAAAATGCATTAAAAGTGATAAACAAAAATACTAATTAGGTGTTATTTCAATTTAATTTAAAATAACATAAAATACAGAAAACAGCTGGATTTTTATTTTCTGTCTGGAGATTTTTTAATATTGCATTTATATCTTTGATTTCAAACTAAACTAAACTAAATTTTCACCATCAGTATTGCACAATCCTTCAGAAATCATTCATTTGCTACATATTATTAGGTAAATAAACATCTACAAAATATAATTCATAATTAATTTTAATTTCAACATTTATTGCAAAACTGCTTGAAATCAAAAATTGAAATTTTATTATTTAATAATTATTAAATGCTGTTTTAGTGCCTTTTAAAGTGCAAGCACCATAAAGTTTTAACATTGCTCTTTATTTTTTTGCAGCTTGCCCGACACAACAAAGTGCTACTCACACTGCTTAAACCAGTAAAGAAGA[T/G]AAAAGAGGAAGAAGAGGAAAGCATCTCCTCTATGGTAACTTACGACTTTGACATTTATGAAGCAGATTTCTAATATGGGTGTCATGGTGTCACAGTGGGTAGCACGATCATCTCACAGCAAGAAGGTCGCTGGTTGGAGCCCTGGCTGGGTCAGTTAGCATTTTTGTGTGGAGTTTGCATGTTCTCCCTGTGTTTGCGTGGTTTTTCTCTGGGTGCTCCGCTTTCTCCCACAGTCCAAAGATATGCGCTATAGGTGAATTGAATAAACTAAATTGGCCGTAGTGTATTTGTGTGAATGCAAGAGCGTATGGGTGTTTCCCAGTGCTGGGTTGTAGCTGGAAAGGCATCCGCTGCATAAAACTTATGCTAGGTGGGTTGGTGGTTCATTCTGCTGTGGCGACCCCTGAATAATAAAGGGACTAAGCCAAAAAGAAAATGAATGAATGATTTTTCAATATAGCCTTTAGAATGCTTCATCATTACAGTATTTTATTCTGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15369
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088119 Nonsense 2094 2656 48 59
ENSDART00000088133 None None 226 None 8
ENSDART00000129359 None None 232 None 7
ENSDART00000142836 Nonsense 1722 2293 37 48
ENSDART00000144488 None None 332 None 10
Genomic Location (Zv9):
Chromosome 8 (position 21870356)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 21300253
GRCz11 8 21332338
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TACAGTATTTTATTCTGGCTTTTTTATTGCAGCTCAAYCTGAACAAGCAG[C/T]AGGAGGAGGAAAAGGAGGATCCACTAGAGCACTACGACCRTCAAACTGCT
Long Flanking Sequence:
TATGGTAACTTACGACTTTGACATTTATGAAGCAGATTTCTAATATGGGTGTCATGGTGTCACAGTGGGTAGCACGATCATCTCACAGCAAGAAGGTCGCTGGTTGGAGCCCTGGCTGGGTCAGTTAGCATTTTTGTGTGGAGTTTGCATGTTCTCCCTGTGTTTGCGTGGTTTTTCTCTGGGTGCTCCGCTTTCTCCCACAGTCCAAAGATATGCGCTATAGGTGAATTGAATAAACTAAATTGGCCGTAGTGTATTTGTGTGAATGCAAGAGCGTATGGGTGTTTCCCAGTGCTGGGTTGTAGCTGGAAAGGCATCCGCTGCATAAAACTTATGCTAGGTGGGTTGGTGGTTCATTCTGCTGTGGCGACCCCTGAATAATAAAGGGACTAAGCCAAAAAGAAAATGAATGAATGATTTTTCAATATAGCCTTTAGAATGCTTCATCATTACAGTATTTTATTCTGGCTTTTTTATTGCAGCTCAATCTGAACAAGCAG[C/T]AGGAGGAGGAAAAGGAGGATCCACTAGAGCACTACGACCGTCAAACTGCTCAGATTGAGGTATAGACAGTGTAGATTACAGTATAAATGCAGTCAAACCTCTGATATCATTTTTGACATGTTTTTATTAGTAGAAGCAGGATAATATAGTTCATTTATTTACAGCAAGACAGTATAGCCAATCAAAATCACATATTACAACCTACAATTATTCAAACAGTGGACTAAAACCAAACAGGAAGTTAAGTAATCTTTGATTGTTTAATTTCATACTGTAATTCTTTCCATACTGTACATTTCTACAGACGTTATCTGACATTATTCTGAGTTCTTTTCTATACTATAGTAAATAAACTGTGTTAATGTGAGCGGTATGAATAATTTTTGGTTTTTCTGCGTAGTATTTCTTTGCACTATAATCCTTGGTGTTATTGTAATTTCTGCTCATCTAGTGATTTAAATGAGTCTGATATTCCGTAAGGTGTTTTTCTATTGGTGTAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7131
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088119 Nonsense 2620 2656 58 59
ENSDART00000088133 None None 226 None 8
ENSDART00000129359 None None 232 None 7
ENSDART00000142836 Nonsense 2248 2293 47 48
ENSDART00000144488 None None 332 None 10
Genomic Location (Zv9):
Chromosome 8 (position 21887469)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 21317366
GRCz11 8 21349451
KASP Assay ID:
554-5041.1 (used for ordering genotyping assays)
KASP Sequence:
GGATCGTCTTAGCTCCACCATGAAAGTGGTCACACAGCTCACAAGCCAGT[T/G]AACAGAGCTGAAAGAACAGGTAGATTTMAAAAATACAGCTTTACAGTGTT
Long Flanking Sequence:
TATTTAAAGGGACAGTTCACCCAAAACTGAACATTTTGTCATCTTTTATTCAGCCTTGTTTCCAAAACATGCTTGCCTCTGTTTCTCTATTGAGCAGAAAATAATATATTCTGAAGAAAGCTGCTAACCATTGACTTCCATGGCATTTGATCTTCTTACTATGGAAGTCAATTTTTTTTAACTTTCTTCAAAATATCTTGTTTTGTGTTCAACAGAATAAATAAACTAAATAATAAATAAAGGTTTTGATCCACTTGAAGGTGGGTAGTAGTGAGTAATTTTTCATTTTTGGTTGATCTATGTCTTTAATTGATCTTGCAATGGGTTTTGATTCAGTCTTCTTGTCGTCTCTTGTTAGAATAAGAACCTGGATTGGTTTCCACGCATGCAGGCCATGTCTCTGGTTGTAACGGATGGAGATGGAGAACAAAATGAGATGAGGAACCTGCAGGATCGTCTTAGCTCCACCATGAAAGTGGTCACACAGCTCACAAGCCAGT[T/G]AACAGAGCTGAAAGAACAGGTAGATTTCAAAAATACAGCTTTACAGTGTTTATACTTGGCACGTTTGTTCAATTAAAACAATCTTCAGTGCAGTAGTTTTATAAACCATTTGAGAGATGTAAACAAAAACAATGGTCCCAACGTATTTCCTGTTTTACATTTTTAATTTCTAAAGCTTCCGAGAATCTAAAAAGAGCCACATATTGATCAATAATGTTATGAGAGCTGTTTTAACATTAAGTTATGAATAAATTGCCTCTTATTTCAGTCATGAAATAGTTAAATAACAAGCAAGAAATGTTCATGGGCCAATGACATGACCACATTGAAATGGTCTGGAAGTGTGTAAGTGTTAGTAGTGTCATCTGAAACTTTAGGAAAAGATGGCTCTCTGTTGTGCATAAACACCAGCATTTTAAATCAGAGCCCATTAGTTCATAGCTTCAGTGTTTGGCTAATTCACACAGGGGCAATGAGTAGCTAATTAAGGAACTATAACT
Associated Phenotype:
Not determined