Busch Lab

ZMP

setdb1b

Ensembl ID:
ENSDARG00000061724
ZFIN ID:
ZDB-GENE-061013-224
Description:
Histone-lysine N-methyltransferase SETDB1-B [Source:UniProtKB/Swiss-Prot;Acc:Q08BR4]
Human Orthologue:
SETDB1
Human Description:
SET domain, bifurcated 1 [Source:HGNC Symbol;Acc:10761]
Mouse Orthologue:
Setdb1
Mouse Description:
SET domain, bifurcated 1 Gene [Source:MGI Symbol;Acc:MGI:1934229]

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa17791 Essential Splice Site Available for shipment Available now
sa36108 Essential Splice Site Available for shipment Available now
sa42708 Nonsense Mutation detected in F1 DNA Not yet available
sa45572 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa32086 Essential Splice Site, Splice Site Available for shipment Available now
sa42707 Nonsense Mutation detected in F1 DNA Not yet available
sa25012 Nonsense Mutation detected in F1 DNA Not yet available
sa36107 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa17791
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088363 Essential Splice Site 145 1214 4 22
ENSDART00000131249 None None 279 None 6
ENSDART00000137317 None None 265 None 5
ENSDART00000144691 None None 128 None 5

The following transcripts of ENSDARG00000061724 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 24098029)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22104495
GRCz11 16 21908747
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CACAGTGGTTCCTCCCAAGAAGRGTTTAACTCAAGCCAAGGACCCAGCRG[T/A]AAGGGAATGCCTTTGTATCAACTGACAAACCGCACGTTTACTGTAGAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36108
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088363 Essential Splice Site 311 1214 7 22
ENSDART00000131249 None None 279 None 6
ENSDART00000137317 None None 265 None 5
ENSDART00000144691 None None 128 None 5

The following transcripts of ENSDARG00000061724 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 24096800)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22103269
GRCz11 16 21907521
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGGTTTGTTGATTTAAATGCATTGCATTGCTGACTTTTTGTATTTTGCA[G/A]GTTCCTGATCTTTTTTGATGATGGTTATGCCTCATATGTGGGCTTGCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42708
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088363 Nonsense 355 1214 8 22
ENSDART00000131249 None None 279 None 6
ENSDART00000137317 None None 265 None 5
ENSDART00000144691 None None 128 None 5

The following transcripts of ENSDARG00000061724 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 24096436)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22102906
GRCz11 16 21907158
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCTGGGAGGATATTGAGGATGCGTCCTGCAGAGATTTCATTGAGGAGTA[T/A]ATCACATCATATCCTAACAGACCCATGGTTTTACTGAAGCCAGGGCAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45572
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088363 Essential Splice Site 631 1214 12 22
ENSDART00000131249 None None 279 None 6
ENSDART00000137317 None None 265 None 5
ENSDART00000144691 None None 128 None 5

The following transcripts of ENSDARG00000061724 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 24094908)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22101378
GRCz11 16 21905630
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTCTATGAATTTCGCCGCATGACTGGCCGCAGACGCCTTAACCGAAAG[G/A]TTTGTAAAGTTGAAGGTGCAGTTCACGATGCGATTCTGATTCTAGTCACC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28644
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088363 Nonsense 830 1214 15 22
ENSDART00000131249 Nonsense 37 279 1 6
ENSDART00000137317 Nonsense 133 265 3 5
ENSDART00000144691 None None 128 None 5

The following transcripts of ENSDARG00000061724 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 24092250)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22098721
GRCz11 16 21902973
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCAGACTGCAGCTCTTTAAGACCCAGAATAAAGGCTGGGGGATTCGGTG[T/A]CTTGATGACATCGCCAAGGGCTCCTTTGTTTGCATCTATGCAGGTAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32086
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site, Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088363 Essential Splice Site 925 1214 16 22
ENSDART00000131249 None None 279 None 6
ENSDART00000137317 Splice Site None 265 None 5
ENSDART00000144691 None None 128 None 5

The following transcripts of ENSDARG00000061724 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 24089091)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22096757
GRCz11 16 21901009
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTAAATCCAACAAGATGGAGGAGCGTAACAGCAGCACAACTGGTAAAAG[T/C]GAGAGACCTACGCACACATCTGATTGATGTACTAATGGTTGTGTAAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42707
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088363 Nonsense 977 1214 17 22
ENSDART00000131249 Nonsense 168 279 3 6
ENSDART00000137317 None None 265 None 5
ENSDART00000144691 None None 128 None 5

The following transcripts of ENSDARG00000061724 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 24088332)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22095998
GRCz11 16 21900250
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACCAGTTCGGTGTGGAGGAGCTACACCACTCGCAGACAGGCCAAGGGAT[T/A]GAAGGAAGGTGAGGAGGGAGCATTAAGATGTTTTAATTGAGAGATTCTAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28643
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088363 Nonsense 996 1214 18 22
ENSDART00000131249 Nonsense 187 279 4 6
ENSDART00000137317 None None 265 None 5
ENSDART00000144691 None None 128 None 5

The following transcripts of ENSDARG00000061724 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 24087558)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22095222
GRCz11 16 21899474
KASP Assay ID:
2260-9581.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGAGAGTCAAGACAGCAAGGATGGAATGAGTGTTTCTGCAGGTGAGGAC[A/T]GAAAGCCTCCACACATGCCAGAAGAGACTGGCAAGAGCAAAGTGGCATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25012
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088363 Nonsense 1083 1214 20 22
ENSDART00000131249 Nonsense 274 279 6 6
ENSDART00000137317 None None 265 None 5
ENSDART00000144691 None None 128 None 5

The following transcripts of ENSDARG00000061724 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 24086334)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22093989
GRCz11 16 21898241
KASP Assay ID:
554-7551.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCTGTGGTGAAAAGGCAGGTGGCTGTGAAGTCCACACGTGGCATTGCTT[T/A]GAAGTCCCACAGTATGATGGTGAAATCAGGTGGAGGGGGTGCAGGAGGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36107
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088363 Nonsense 1205 1214 22 22
ENSDART00000131249 None None 279 None 6
ENSDART00000137317 None None 265 None 5
ENSDART00000144691 None None 128 None 5

The following transcripts of ENSDARG00000061724 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 24082037)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22088128
GRCz11 16 21892380
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAATTATGAGGTAGGCAGTGTAGAGGGCAAGGAACTTCTGTGCTGCTGT[G/T]GATCAACAGAATGCAGAGGACGACTGCTGTAACACACACTTGAACACATG
Associated Phenotype:
Not determined