Busch Lab

ZMP

si:dkeyp-34f6.5

Ensembl ID:
ENSDARG00000061723
ZFIN ID:
ZDB-GENE-060503-182
Description:
transmembrane protein 64 [Source:RefSeq peptide;Acc:NP_001121723]
Human Orthologue:
TMEM64
Human Description:
transmembrane protein 64 [Source:HGNC Symbol;Acc:25441]
Mouse Orthologue:
Tmem64
Mouse Description:
transmembrane protein 64 Gene [Source:MGI Symbol;Acc:MGI:2140359]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa23556 Nonsense Available for shipment Available now
sa12461 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23556
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088387 Nonsense 156 346 1 3
ENSDART00000136289 Nonsense 156 348 1 3
Genomic Location (Zv9):
Chromosome 19 (position 32778202)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 31945491
GRCz11 19 31532804
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCTGCGGATGGGGGTATATTGTGCTCAACGTGGCCGCGGGATATTTATA[T/G]GGGTTTGTGTTGGGCATGGGACTGGTGATGGTCGGAGTTCTGATCGGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12461
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088387 Nonsense 294 346 3 3
ENSDART00000136289 Nonsense 296 348 3 3
Genomic Location (Zv9):
Chromosome 19 (position 32796915)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 31964204
GRCz11 19 31551517
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTGTCTGTTCTTCTCATCAGATCTTCATCAGCATCGGCCTGATGTTTTA[C/A]RTTGTACATCGAGCACAAGTAGAACTGAACGCTGCCATTGCCGCCTGCCA
Associated Phenotype:
Not determined