Busch Lab

ZMP

si:ch211-203l9.3

Ensembl ID:
ENSDARG00000061713
ZFIN ID:
ZDB-GENE-060503-680
Description:
tumor protein D52 [Source:RefSeq peptide;Acc:NP_001038486]
Human Orthologue:
TPD52
Human Description:
tumor protein D52 [Source:HGNC Symbol;Acc:12005]
Mouse Orthologue:
Tpd52
Mouse Description:
tumor protein D52 Gene [Source:MGI Symbol;Acc:MGI:107749]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa36869 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa36870 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa36869
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088340 Essential Splice Site 7 187 1 6
ENSDART00000121829 Essential Splice Site 7 187 1 6
ENSDART00000128465 None None 222 None 6
Genomic Location (Zv9):
Chromosome 19 (position 33149939)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 32317746
GRCz11 19 31905059
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCACAACATCAAGAGTCCTCAAAGACAGGATGGAGGAGAACGATAAAGG[T/C]AGTTGAATTCTTCTGCAAATGTGATGTGACATGTCGGCACAGATTAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36870
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088340 Nonsense 146 187 5 6
ENSDART00000121829 Nonsense 146 187 5 6
ENSDART00000128465 Nonsense 182 222 5 6
Genomic Location (Zv9):
Chromosome 19 (position 33183469)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 32351276
GRCz11 19 31938589
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCAGGAACACACCCTCCTTCAAGTCATTTGAGGAGAAAGTGGAAACCT[T/G]AAAGGTAAACCCACAAGCATAATATCAACACTGTGTGTGTGATCTAAACA
Associated Phenotype:
Not determined