Busch Lab

ZMP

si:dkey-149j18.1

Ensembl ID:
ENSDARG00000061699
ZFIN ID:
ZDB-GENE-050420-109
Description:
Novel protein similar to vertebrate signal-induced proliferation-associated 1 like family [Source:Un
Human Orthologue:
SIPA1L3
Human Description:
signal-induced proliferation-associated 1 like 3 [Source:HGNC Symbol;Acc:23801]
Mouse Orthologue:
Sipa1l3
Mouse Description:
signal-induced proliferation-associated 1 like 3 Gene [Source:MGI Symbol;Acc:MGI:1921456]

Alleles

There are 9 alleles of this gene:

Allele Name Consequence Status Availability
sa23346 Essential Splice Site Available for shipment Available now
sa36697 Nonsense Mutation detected in F1 DNA Not yet available
sa15094 Nonsense Available for shipment Available now
sa45646 Nonsense Mutation detected in F1 DNA Not yet available
sa43150 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa43151 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa23347 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23346
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088293 Essential Splice Site 455 1718 None 20
ENSDART00000147385 Essential Splice Site 415 1678 None 20
Genomic Location (Zv9):
Chromosome 18 (position 35461174)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 37140330
GRCz11 18 37121338
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACGTTGACCTGGGGGCCAGAAACTACCATGAGCACTTCTATGGGAAAGG[T/A]AAGAAATCTATTGCTTCCATCTAGATAATACATTACACTACGAGATGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36697
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088293 Nonsense 632 1718 5 20
ENSDART00000147385 Nonsense 592 1678 5 20
Genomic Location (Zv9):
Chromosome 18 (position 35483600)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 37162756
GRCz11 18 37143764
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTGTTTTATAGCGGACTCAACTGGAACACACTCCCTGTACACCACCTA[T/A]CAGGACTATGAGATCATGTTTCACGTGTCCACCATGCTTCCATACATGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15094
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088293 Nonsense 1027 1718 9 20
ENSDART00000147385 Nonsense 987 1678 9 20
Genomic Location (Zv9):
Chromosome 18 (position 35518137)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 37197293
GRCz11 18 37178301
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCGGAGCCAGTGGCCGCAGGCTATCGAGCAGKGCAGCGAACCCCAGTAT[G/A]GCGCTGGGACAGTCCTCCTGCTACTCACAGCTCTGCCCAGCGCTGGACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45646
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088293 Nonsense 1082 1718 10 20
ENSDART00000147385 Nonsense 1042 1678 10 20
Genomic Location (Zv9):
Chromosome 18 (position 35518418)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 37197574
GRCz11 18 37178582
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTATTTCTGTCTCCTCCCACAGGCCTGTCAGTTATCCAGAAAACCATTA[C/A]AGCGTGTCTCCTCTTGCTGGGGACAGAGGGCCGTACAGAAACCCTTCGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43150
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088293 Essential Splice Site 1487 1718 16 20
ENSDART00000147385 Essential Splice Site 1447 1678 16 20
ENSDART00000088293 Essential Splice Site 1487 1718 16 20
ENSDART00000147385 Essential Splice Site 1447 1678 16 20
Genomic Location (Zv9):
Chromosome 18 (position 35536937)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 37216093
GRCz11 18 37197101
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGCTATCGTACTGATTTGTTGTTGTTGTGTGTGTGTGTGCTTGTCTCC[A/T]GTCTCCTCATCGGACACTGCAGCGCACTTTCTCAGATGAGAGTCTGTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43151
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088293 Essential Splice Site 1487 1718 16 20
ENSDART00000147385 Essential Splice Site 1447 1678 16 20
ENSDART00000088293 Essential Splice Site 1487 1718 16 20
ENSDART00000147385 Essential Splice Site 1447 1678 16 20
Genomic Location (Zv9):
Chromosome 18 (position 35536937)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 37216093
GRCz11 18 37197101
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGCTATCGTACTGATTTGTTGTTGTTGTGTGTGTGTGTGCTTGTCTCC[A/T]GTCTCCTCATCGGACACTGCAGCGCACTTTCTCAGATGAGAGTCTGTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23347
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088293 Nonsense 1588 1718 17 20
ENSDART00000147385 Nonsense 1548 1678 17 20
Genomic Location (Zv9):
Chromosome 18 (position 35537319)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 37216475
GRCz11 18 37197483
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAGGCTGGATCCTGGACTCATGCCTCTTCCTGACACTGCCTGTGGTCTC[G/T]AGTGGTCCAGCCTCGTCAATGCAGCCAAAGCTTATGAAGGTACGAGTGAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29066
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088293 Nonsense 1589 1718 17 20
ENSDART00000147385 Nonsense 1549 1678 17 20
Genomic Location (Zv9):
Chromosome 18 (position 35537324)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 37216480
GRCz11 18 37197488
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGATCCTGGACTCATGCCTCTTCCTGACACTGCCTGTGGTCTCGAGTG[G/A]TCCAGCCTCGTCAATGCAGCCAAAGCTTATGAAGGTACGAGTGAGTGTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29067
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088293 Essential Splice Site 1643 1718 18 20
ENSDART00000147385 Essential Splice Site 1603 1678 18 20
Genomic Location (Zv9):
Chromosome 18 (position 35539951)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 37219107
GRCz11 18 37200115
KASP Assay ID:
2261-2448.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGCACTTCCACACGCCACAGACGCCTCGCACAACTCCTACTTTCAGCAG[G/A]TAACACACACACACACACACACACTCAAATAAATAAATGTCATATGATGA
Associated Phenotype:
Not determined