Busch Lab

ZMP

si:ch211-212d10.3

Ensembl ID:
ENSDARG00000061692
ZFIN ID:
ZDB-GENE-050208-755
Description:
si:ch211-212d10.3 [Source:RefSeq peptide;Acc:NP_001038308]
Human Orthologue:
YJEFN3
Human Description:
YjeF N-terminal domain containing 3 [Source:HGNC Symbol;Acc:24785]
Mouse Orthologue:
Yjefn3
Mouse Description:
YjeF N-terminal domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2681845]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa24146 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24146
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088270 Nonsense 160 246 5 6
Genomic Location (Zv9):
Chromosome 22 (position 18686349)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 18437284
GRCz11 22 18462262
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACGCCATCCTGGGACCCGAAACTGACCACAAGGATGTGAAGGAGCCTTA[T/A]GCTGGGATGCTGGTGACTCTTAAGCAGGTCAAAATACCCATCGTTAGTGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4201
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088270 Nonsense 230 246 6 6
Genomic Location (Zv9):
Chromosome 22 (position 18688677)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 18439612
GRCz11 22 18464590
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGCATTTTCTGGCGGGGCGATTCCTGCCCTATGACATTCAGAAAAAATA[T/A]GAACTCAATCTGCCAGAATTTCCCGGCACAGAATGTATTATAGAACTGTA
Associated Phenotype:
Not determined