Busch Lab

ZMP

hcn4

Ensembl ID:
ENSDARG00000061685
ZFIN ID:
ZDB-GENE-050420-360
Description:
Novel protein similar to vertebrate hyperpolarization activated cyclic nucleotide-gated potassium ch
Human Orthologue:
HCN4
Human Description:
hyperpolarization activated cyclic nucleotide-gated potassium channel 4 [Source:HGNC Symbol;Acc:1688
Mouse Orthologue:
Hcn4
Mouse Description:
hyperpolarization-activated, cyclic nucleotide-gated K+ 4 Gene [Source:MGI Symbol;Acc:MGI:1298209]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa11188 Nonsense Available for shipment Available now
sa39186 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa11188
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093300 Nonsense 315 1124 2 9
ENSDART00000136140 Nonsense 315 1068 2 8
Genomic Location (Zv9):
Chromosome 18 (position 899580)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 1207517
GRCz11 18 1099893
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGCGCTCGTGGTTCGTGGTGGACTTCATCTCCTCCATTCCCGTGGACTA[T/A]ATCTTCCTCATAGTGGAGACGCGCATYGATTCGGATTTCTACAAGACGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39186
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093300 Nonsense 586 1124 6 9
ENSDART00000136140 Nonsense 586 1068 6 8
Genomic Location (Zv9):
Chromosome 18 (position 830039)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 1137976
GRCz11 18 1030352
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCACTAAACTTCGCTTCGAGGTCTTCCAGCCGGGCGACTACATCATACGA[G/T]AAGGAACCATCGGGAAGAAGATGTACTTCATCCAGCACGGTGTGGTGAGC
Associated Phenotype:
Not determined