Busch Lab

ZMP

ENSDARG00000061682

Ensembl ID:
ENSDARG00000061682
Human Orthologue:
BICC1
Human Description:
bicaudal C homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:19351]
Mouse Orthologue:
Bicc1
Mouse Description:
bicaudal C homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1933388]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa36388 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa23051 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36388
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088242 Essential Splice Site 463 964 11 24
Genomic Location (Zv9):
Chromosome 17 (position 20828338)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 20978349
GRCz11 17 20998185
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAAACAAAAAGTGCTCAGAGGTAGCTTAAATAATGTGTTGGTGCTCTTT[G/A]GGTAAGAGAATCATCAGAATAAACAGCAAAAATTAGTCCAAGGCACTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23051
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088242 Nonsense 811 964 21 24
Genomic Location (Zv9):
Chromosome 17 (position 20820136)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 20970147
GRCz11 17 20989983
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACACCAAATCTGATAATTGGGGTGATTTGAATGGGAATGTCAATATCAAT[G/T]GAAATGGACCATCAGGAAATTCAGAATTTTCCCAGACTGTCAGCAGCCCG
Associated Phenotype:
Not determined