Busch Lab

ZMP

zgc:162707

Ensembl ID:
ENSDARG00000061664
ZFIN ID:
ZDB-GENE-070424-37
Description:
UPF0524 protein C3orf70 homolog B [Source:UniProtKB/Swiss-Prot;Acc:A3KNX6]
Human Orthologue:
C3orf70
Human Description:
chromosome 3 open reading frame 70 [Source:HGNC Symbol;Acc:33731]
Mouse Orthologue:
2510009E07Rik
Mouse Description:
RIKEN cDNA 2510009E07 gene Gene [Source:MGI Symbol;Acc:MGI:1919440]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa41366 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa41366
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088199 Nonsense 226 249 3 3
ENSDART00000135447 None None 122 None 4
Genomic Location (Zv9):
Chromosome 9 (position 12681568)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12434133
GRCz11 9 12405336
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGATGAGCTCAGCACGGATGGACACTCCAGTCCGGGGAGTCTATGGGAC[C/T]AGGATGAATGCACCCTGCTGTCCCCTTCCAAATCTATGGTGGAGATTATT
Associated Phenotype:
Not determined