Busch Lab

ZMP

si:rp71-23d18.7

Ensembl ID:
ENSDARG00000061602
ZFIN ID:
ZDB-GENE-050208-601
Description:
Novel protein similar to vertebrate synovial sarcoma, X breakpoint 2 interacting protein (SSX2IP) [S
Human Orthologue:
SSX2IP
Human Description:
synovial sarcoma, X breakpoint 2 interacting protein [Source:HGNC Symbol;Acc:16509]
Mouse Orthologue:
Ssx2ip
Mouse Description:
synovial sarcoma, X breakpoint 2 interacting protein Gene [Source:MGI Symbol;Acc:MGI:2139150]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa24177 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24177
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088027 Nonsense 174 485 4 11
ENSDART00000140430 Nonsense 174 471 4 10
Genomic Location (Zv9):
Chromosome 22 (position 25189549)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24689455
GRCz11 22 24717079
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGCCACACAATATAATCATGATATTAAGAGGAGAGAAAGGGAGCACAAC[A/T]AAGTAAAAGAACGCCTCAGTCAAGTGCTTATTGCCAAAAAGGATAACAAA
Associated Phenotype:
Not determined