Busch Lab

ZMP

tmem2

Ensembl ID:
ENSDARG00000061600
ZFIN ID:
ZDB-GENE-030131-2179
Description:
Transmembrane protein 2 [Source:UniProtKB/Swiss-Prot;Acc:A3KPQ7]
Human Orthologue:
TMEM2
Human Description:
transmembrane protein 2 [Source:HGNC Symbol;Acc:11869]
Mouse Orthologue:
Tmem2
Mouse Description:
transmembrane protein 2 Gene [Source:MGI Symbol;Acc:MGI:1890373]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa2236 Essential Splice Site F2 line generated Not yet available
sa13058 Nonsense Available for shipment Available now
sa33599 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa2236
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088011 Essential Splice Site 403 1390 4 23
ENSDART00000133217 Essential Splice Site 403 1378 4 22

The following transcripts of ENSDARG00000061600 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 27425006)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25180304
GRCz11 5 25780457
KASP Assay ID:
554-3001.1 (used for ordering genotyping assays)
KASP Sequence:
TGTGGATGGTGTCGGTTTCACTGTTACTGCTTACAGTGAATGGAGTAATG[G/A]TATGYTTGGACTGCTTCCAATAAAATCCACATTATTGAACAAGAATATRT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13058
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088011 Nonsense 800 1390 12 23
ENSDART00000133217 Nonsense 800 1378 12 22

The following transcripts of ENSDARG00000061600 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 27444484)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25199782
GRCz11 5 25799935
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTAAAAATAATGMTCTGGGTGCCTGGATTCGTGGAGGTGACATCATCATA[C/T]GAAACTCAGGGTAAGAGAGAGACAAAACTTCTTARTTTATAGTTCACTCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3523
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088011 Nonsense 1017 1390 17 23
ENSDART00000133217 Nonsense 1005 1378 16 22

The following transcripts of ENSDARG00000061600 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 27449307)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25204605
GRCz11 5 25804758
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACATACAGACKCAGGCCGCATCTAATCTGAGCCTGTCCATCARTAGAGAC[G/T]AATACYCTGATAAACCAATGGTTCTCAGAGGCATCAGAACCAAGACATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33599
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088011 Nonsense 1317 1390 22 23
ENSDART00000133217 Nonsense 1305 1378 21 22

The following transcripts of ENSDARG00000061600 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 27456653)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25211951
GRCz11 5 25812104
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGCTAGCTTTGCTGGTGTCGCACAATATCTGGAGTCTTTGGGATCTGCT[A/T]AAACACCAGACCTTCAGAATAAAGGTACAGTACTTTTACAACATGGAAAA
Associated Phenotype:
Not determined