Busch Lab

ZMP

ctdspl2a

Ensembl ID:
ENSDARG00000061587
ZFIN ID:
ZDB-GENE-061013-647
Description:
CTD small phosphatase-like protein 2-A [Source:UniProtKB/Swiss-Prot;Acc:Q08BB5]
Human Orthologue:
CTDSPL2
Human Description:
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2 [Source:HGN
Mouse Orthologue:
Ctdspl2
Mouse Description:
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2 Gene [Sourc

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa38116 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa11079 Essential Splice Site Available for shipment Available now
sa38117 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa38118 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa38116
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087978 Essential Splice Site 109 469 None 13
ENSDART00000132698 Essential Splice Site 119 143 None 4
Genomic Location (Zv9):
Chromosome 25 (position 33483106)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 32093508
GRCz11 25 32504465
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCAGCAGAGCAAACCCCAAAACCCGCAGGAAAGGCCCTGTCAATGGAGG[T/C]AAGAGATGCTGAGCAGGGCCTCAGACTAACATTAATACATTTGGTGTCAC
Long Flanking Sequence:
GCAAGCCCTAAAAGCGTTTGTGCCCTGCGCTTTGCGCATGGACCGTCAAAATAGAGCCCTAGGTCAGATTAATATGAAAATGTTTGCTTTAAATTAATTCACTTACTGTAAGTGCTGTAATGAGCAACCACTGCCAATACAACAATCTGAATATTCTTTAAAAAAACTATTAATTTAACTAATAAGTTTAACTAATAGATAATTATTTACAGTATTTTTGAATGTCCACGGTATCAATATTGTCCATTATCAAGATATATTTAACATCGGCATATGTCTAATATTCAGATGATGTTTATGCGTTTTAACTGCTCTAATTGACGTTGGCAGGACTCATTGATCGATCTGTCTTTGTGTCAGGTGGAGCAGTGCACTCCTGCGAAGAGAAGCCGTGTTGACTGTGATTCAGACAGTAATCTGATCACATCCACTCCGACCGGTGGAAACCTGCCCAGCAGAGCAAACCCCAAAACCCGCAGGAAAGGCCCTGTCAATGGAGG[T/C]AAGAGATGCTGAGCAGGGCCTCAGACTAACATTAATACATTTGGTGTCACCACACAAGTGATATTACATGTTTTGTATTTTAAAAATGCACTTTTGAGTTTTAAATGAGTAGTTTGAATTTGTATGTAGATTTGATTATTATTATTATTATTATTATTATTATTATTATTAAAAAAACAGTGTATGTGAAATTGGGACAACTTAAATATTCTCTGTTCTTATTAAAATGAACCATTGGTGTTCCACTGAATCATACAATAATAACACACATAGCACACTATGCCTTTAAATACTAAGGAAAAAACTAGTGTACGTTTTATATAAATTAGTTTAGGTTTGATGTTTATAATAAATACTGTTTATTTTGAATGTCACTAGTTTCAGTTTGAAAGTACTATTTTTAATATTTTATTAACAAAACAGCAATACACTACCTGACAAAAGTCTTTTCGTCGATCCCAGTTGTAAGAGCAACAAATAATAACTTGACTTCTACTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11079
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087978 Essential Splice Site 157 469 4 13
ENSDART00000132698 None None 143 None 4
Genomic Location (Zv9):
Chromosome 25 (position 33485522)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 32095924
GRCz11 25 32506881
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CACCATCTTCTCTCCTGTTTTTAGCTTCTTCTCGCCCGCCAACAAAAACG[G/A]TAAGCACCYGTGATCTCACTTGTCAGCTGATGAATGTTTTGTATGTGGCT
Long Flanking Sequence:
CTCAAGCAGCGCAACACATTTAAAACCCCTGAGTGTGTCAGCAGATTCATAAACGGTGTACCAGCCTTTTCAAACTTATTATGAAGAACAAACAATAACTTTGTTTCTGGTATACCAGGGCCTTTAGTGTTGCTACTATAAATGCTTGCTAAATGTTGGTGATTTGCATATTGAAATGCTTTGTGACTTTTATTGTTGTGCAATGTTTTTTTTTTTCTGATTCAATCATTTAGTTACATTCTAGCCCTGTAATCAGGCTACTGTACGTTTCAGAGACCTGGTTGTAATTTAGCTGTGTCATGAAGACTGTCTGTTTTCTTGGTGTTTTAACATTTTCATGCTCTTTTGCTCAGATACCATGACAGGTCAGAATAAACCAGTAAAGCCCAATGGGAAGCTGGAGGTGCAGGCGGAGACTCCGAGCAGTCCGCCTCGCACCACTCTCCTGGGCACCATCTTCTCTCCTGTTTTTAGCTTCTTCTCGCCCGCCAACAAAAACG[G/A]TAAGCACCCGTGATCTCACTTGTCAGCTGATGAATGTTTTGTATGTGGCTAAGAGACACCAAGATATTTATGACCTAGTCATTAAGATCTTAGTTCCATCCAAGTTATTTATCAAATGTTGAGAATTGAACAATCATGTTTATTTTAAATATACATTTTATTTATTTATATATTTCAGGGTGTCCCTCTGTCACACTCTGTTTGGGCCCAAATGACCTCAGAATTTCAGAGTTTGATATTCCCTTTGACGTCTTTATTAAATTATCTTCAAATCTGACGTTTTATAGAGTCTCTTTTAAAGCAAAACCAATTCCATTTTAAATGATCTGAACTCGAGGATGAATAACAGCTGGAGCATTGACTGGGAATGCTGTTTATCGTTAGTCTAAAAGAGGACCATAAAACCAGATCAAGACTATCAGAGAATTCACAGAAGCATATATAAGAAGCAGTATTTTTAAATCAAACTTCAGTGTTTCTCAGCTTAATCGTTCTTGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38117
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087978 Essential Splice Site 158 469 4 13
ENSDART00000132698 None None 143 None 4
Genomic Location (Zv9):
Chromosome 25 (position 33485523)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 32095925
GRCz11 25 32506882
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCATCTTCTCTCCTGTTTTTAGCTTCTTCTCGCCCGCCAACAAAAACGG[T/G]AAGCACCCGTGATCTCACTTGTCAGCTGATGAATGTTTTGTATGTGGCTA
Long Flanking Sequence:
TCAAGCAGCGCAACACATTTAAAACCCCTGAGTGTGTCAGCAGATTCATAAACGGTGTACCAGCCTTTTCAAACTTATTATGAAGAACAAACAATAACTTTGTTTCTGGTATACCAGGGCCTTTAGTGTTGCTACTATAAATGCTTGCTAAATGTTGGTGATTTGCATATTGAAATGCTTTGTGACTTTTATTGTTGTGCAATGTTTTTTTTTTTCTGATTCAATCATTTAGTTACATTCTAGCCCTGTAATCAGGCTACTGTACGTTTCAGAGACCTGGTTGTAATTTAGCTGTGTCATGAAGACTGTCTGTTTTCTTGGTGTTTTAACATTTTCATGCTCTTTTGCTCAGATACCATGACAGGTCAGAATAAACCAGTAAAGCCCAATGGGAAGCTGGAGGTGCAGGCGGAGACTCCGAGCAGTCCGCCTCGCACCACTCTCCTGGGCACCATCTTCTCTCCTGTTTTTAGCTTCTTCTCGCCCGCCAACAAAAACGG[T/G]AAGCACCCGTGATCTCACTTGTCAGCTGATGAATGTTTTGTATGTGGCTAAGAGACACCAAGATATTTATGACCTAGTCATTAAGATCTTAGTTCCATCCAAGTTATTTATCAAATGTTGAGAATTGAACAATCATGTTTATTTTAAATATACATTTTATTTATTTATATATTTCAGGGTGTCCCTCTGTCACACTCTGTTTGGGCCCAAATGACCTCAGAATTTCAGAGTTTGATATTCCCTTTGACGTCTTTATTAAATTATCTTCAAATCTGACGTTTTATAGAGTCTCTTTTAAAGCAAAACCAATTCCATTTTAAATGATCTGAACTCGAGGATGAATAACAGCTGGAGCATTGACTGGGAATGCTGTTTATCGTTAGTCTAAAAGAGGACCATAAAACCAGATCAAGACTATCAGAGAATTCACAGAAGCATATATAAGAAGCAGTATTTTTAAATCAAACTTCAGTGTTTCTCAGCTTAATCGTTCTTGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38118
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087978 Nonsense 261 469 7 13
ENSDART00000132698 None None 143 None 4
Genomic Location (Zv9):
Chromosome 25 (position 33488505)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 32098907
GRCz11 25 32509864
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTAAATGAAGCCACATATTCACATGCTCACATGTGTCTGTCTTCCAGTTA[T/A]TTCTTTATCAAACACGTGCCACCGCTGACTGAAGAGCAGCTCACCCGTAA
Long Flanking Sequence:
GGGGAGGCATTCAGCGATCAAGAATAGTCAGCGCACAGTTTGTAAGAGTGTTTCTACAGGTGTTTTGTCAGGCCCACTCACCTGTGAAGCACACTTTATGTTTGATCTAGAGCTATGTCGTGATTGTAGGCCAGTGTCTGGTGCAAGTGTTGGTTAAAATGAAGAGTGTGTTTACTACAGGTGGTTTGTCAAGCCACTCACCTGTGTGATGCAGCACAAGGGAAAGTTTCACATGTTACATTTGTGAATCTGAGTGTGTTGGACTTGTAGTTTTCAATTGTGTTGCACCCTGTATATTAATGCATAAAGATGTCTATCCTCTCTCTTTGTCAGCTGTAGGATCCAACAGCAATTACCCAGATGTCCCTCCATCACCTCCTGCAGAGGGGACTTATGAAGAGGACTGGGAAGTTTTTGATCCGTGAGTCAAATTTCAACTTGAATTTGTCAGTAAATGAAGCCACATATTCACATGCTCACATGTGTCTGTCTTCCAGTTA[T/A]TTCTTTATCAAACACGTGCCACCGCTGACTGAAGAGCAGCTCACCCGTAAACCTGCGCTGCCTCTGAAAACCAGGAGCACGCCCGAGTTCTCCCTTGTTCTCGATCTAGTGAGTCTGTAATCATTTGTTTACACATTAATAACAAACAGTCTACATACACAAAGCAAACTCCCTGAAATGAACTCTAATGTTGGGAACTGAAATGTTTATAAATTCTCCAACCAGTTGGAATCAAATTTTTCACTCTAGGATGATATACAAGCTTTTAATACGATTGTGTTGGCTTTAATTCTGTGAGAAGCTTATTTTATTCAGTTCATACTTTTGAAGTGATTTTTAACACTTAATCCAAATAGGCCTGTCACAGCAGCAGAGCGCGTTAGTTGTGCGCTTCGCTTACACACTGCTTAATAGCAGACAGGATGTAGAGCTATACGCAAATATCTTTACAAATGAAAAATAATTAAAATATTGAGGATATATAGGATATAAGGGGATAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5111
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087978 Nonsense 411 469 11 13
ENSDART00000132698 None None 143 None 4
Genomic Location (Zv9):
Chromosome 25 (position 33494537)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 32104939
GRCz11 25 32515896
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACATCCTCGGTCGAGATCTTTCCAAGACTGTCATCATCGATAACTCCCCG[C/T]AGGCTTTTGCCTAYCAGGTTTGTGGACAKTCTGCTCTGCTGTTGTGCTGG
Long Flanking Sequence:
ATAAATGTACAATGAGCAAGATTCAAAGTGTTTTGCAAACAAAAGCAGCAAAATGTGCAGGCATTTTAGTGCAAAACAAAAGATGGCTTGCCTGCCAAACTGACGTCAAACTGTACAAAACATCACTGTACAAAACATGGACAAGTAGTCACAGGCAAATTAAACTTTAGTGACACGGCATCAGTGGCCCAATCGGGCCAGTAACAATCCTGTCTACTGTCCCGAGCATCTTACACGCTGGCCCCGGGCCATCGGGCAGTCCTTATTGTTGAGCCCTGCTTTAAATCTATTGTAGGGGGCTTAAAGCAGTGTTTAGGACACTTTTTAATAACATGGTTTCTTTAATTGTGAAAATTTAAGCTGAATATGTCTCTTTCTGGTGACGTCTCAGGCACAGATTGTTTCGTGAGCACTGCGTGTGTGTTCAAGGGAACTACATTAAGGACCTGAACATCCTCGGTCGAGATCTTTCCAAGACTGTCATCATCGATAACTCCCCG[C/T]AGGCTTTTGCCTACCAGGTTTGTGGACATTCTGCTCTGCTGTTGTGCTGGTGGCGGGTTATTAGTATGTAAAGCTCAGGATGTGCTTTTCTCGTTGCAGCTTTCCAATGGGATCCCCATTGAGAGTTGGTTCGTGGACAAGAATGACAATGAGCTCCTAAAGCTGGTGCCGTTTTTGGAGAAGCTGGTGGAACTGGTACGTGCGTCTTGTCTTTTGTGTGTGCTGCTTTTTAAAGGGGAATAATGCGGGGTTTTGTTTATTTTTTCATACAGTAGTCAGGGCTTGGAAGTGGATTTAATTTAAAGTCAGTACAATTTGTCCTAAGATAAGAGTAGACCTGTCAATATATCAACGTACCGTGCAAAACTTGGAGAGGACCTCAATCATTTTTGCTGTCGCAATATATATTTACAAATTCACAAATAACGTTAAAGCCACTTTACAATGACGTTTACATTCTTTGCATGTTCTAGTATCTTAACTACATATTTATAGGCTGT
Associated Phenotype:
Not determined