Busch Lab

ZMP

socs5a

Ensembl ID:
ENSDARG00000061573
ZFIN IDs:
ZDB-GENE-061013-408, ZDB-GENE-061013-408
Description:
suppressor of cytokine signaling 5a isoform 1 [Source:RefSeq peptide;Acc:NP_001107230]
Human Orthologue:
SOCS5
Human Description:
suppressor of cytokine signaling 5 [Source:HGNC Symbol;Acc:16852]
Mouse Orthologue:
Socs5
Mouse Description:
suppressor of cytokine signaling 5 Gene [Source:MGI Symbol;Acc:MGI:2385459]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa45460 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa45460
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087968 Nonsense 367 488 2 3
ENSDART00000112562 Nonsense 367 528 2 2
Genomic Location (Zv9):
Chromosome 12 (position 26570981)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 24952852
GRCz11 12 25044212
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGTGCACACCCAGATCGACTATATCCATTGCTTGGTTCCAGATCTGCTG[C/T]AGATCACAGCCCTTCCCTGTTACTGGGGTGTGATGGACCGTTACGAGGCT
Associated Phenotype:
Not determined