Busch Lab

ZMP

rc3

Ensembl ID:
ENSDARG00000061570
ZFIN ID:
ZDB-GENE-031007-6
Human Orthologue:
DMXL2
Human Description:
Dmx-like 2 [Source:HGNC Symbol;Acc:2938]
Mouse Orthologue:
Dmxl2
Mouse Description:
Dmx-like 2 Gene [Source:MGI Symbol;Acc:MGI:2444630]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa17811 Nonsense Available for shipment Available now
sa746 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17811
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087935 Nonsense 528 1536 11 17
Genomic Location (Zv9):
Chromosome 18 (position 39464827)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 39769830
GRCz11 18 39749207
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCCACGGGTGATGCAAAMTCTCTCAGTAAGAACATCATGATGTAYGCCTG[T/A]ACGTTTATGGACCAGGACAGCTGCAGTGCTCTGGAGGAGAAGCGCAGCGA
Long Flanking Sequence:
AAATAAATTTCATGTTAATAATAAATAAACTCCATGTTAATCAATGAAATTCTTGTTAATAATAATTTGTTAATAATTCCATGTTAATAACAAATAAATACATTAAATAAATAAAATCTAAATTAAATTAAATTAATTACAAGTTCTAAAATAAATACTAACAAATTAACAAATTAATTCCATTTAAAAGCAATAAATTCAATGTTAACAAAAACAAATAATTTACACGTTGTTGTTAGAATTTTAAGGTCAAGAGTGGTTGTGTAAGCAACCAAAGGTATTTTTAAATATCGCTCACCCTATACTCTCTTTTCGTTGGTGATGACTATTAAAAACCTCATTTTGATGGACCATTTTTTGTTACTCGATTCAATTCAACACACAAACTGAATAAAACCTGTTTGTTTTCTCCTTCAGGTATCATTCTCGTCTCGTATCCCTGTCGCATTCCCCACGGGTGATGCAAACTCTCTCAGTAAGAACATCATGATGTACGCCTG[T/A]ACGTTTATGGACCAGGACAGCTGCAGTGCTCTGGAGGAGAAGCGCAGCGAGCGTCGAGTTCCTCAGAGCGCATCAGCTTCTGCTGGTCTCAGCTCTCTCGGACACTCTCTCGCTGCTGTCATTGGCCCTGCTGTCATGATGGTGTCTAAACACGTAGACGGCTCCCTCAACCAATGGGCTGTGACCTTTGCTGAGAAGTCTGCCTTTTCCAATGTCCTCACGGTTTCGCACAAGTTCCGCTACTGCGGGCACCGTTTCCATCTCAATGACTTGGCTTGTCACACTGTACTTCCCTTACTTCTGACATCATCGCATCACAATGCACTGTTGACTCCGCCCTCTGGATCCGGAAGCATTGATGGAGATCTGATTGGGGGCGTGGCTCAACAGCCCACCAGGCCAATGAGAGGCATTCCTCGTAAACAGCTACGAAATGCAGCTACGCGTACTTTCCATGACCCAAATGCGATCTACAGTGAGCTGATTCTCTGGAGAGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa746
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087935 Essential Splice Site 844 1536 15 17
Genomic Location (Zv9):
Chromosome 18 (position 39471441)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 39763216
GRCz11 18 39743117
KASP Assay ID:
554-0653.1 (used for ordering genotyping assays)
KASP Sequence:
AAAAAAAAGCTTTTCGTTCCCTTTGATATCCATTCCACACATTTTTTTYA[G/A]AACATTATATCTGGGTTGTCTTTGTTGTAGATTACCAGCCACCACCGTTC
Long Flanking Sequence:
TACTTTTAGAAAACATTTAATTTATATCTTTTTAAATAATTTTAACTAATGAATTTTTTTCTTAAGCACAGAAAAATTATATATATATATATATATATATATATATATATATATATATATATATATTACTCTGCTTCTCTGAATTTATTGATTTATTTAGAACTGTGGAATATTTGTACAGTATTTACTGTTTACCTAAATATTTAAAGATTAAAGATTACCTAAACATTTAAAGTAATCCCTCATATTTTGAGCAGAAAATTTATTTAATTACAGTAACTAATCACACTCAACAATGTGTGCAGTATTATAATGTTCTGTTTGTGTTGCTCAGTGCGGCTCGAACACACAGCTGCTCCACGTATTCCAGGAGGATTTTATTTTGGGATACAAACCACACGAAGACATTCCAGATTTCAACATTAATAGTTTTCCCTCTGGAGAAGGTACAAAAAAAAGCTTTTCGTTCCCTTTGATATCCATTCCACACATTTTTTTTA[G/A]AACATTATATCTGGGTTGTCTTTGTTGTAGATTACCAGCCACCACCGTTCTCAGAGAAGTTCTATTTGGTGGTGATCGAGAAGGATGCTAATAGGAACTCAGTGTTACAGATGTGGCATCTTCATCTGCGCTCGGTGCAGGCGTGTGTGGGTGCGTATGAAGTGGGTTATTTGTGAAATGATGACACATCTGTCAGCGGATAGCATCTGAGAGGAAACTGTGAAGGGAGTCTCATGAATGGAAAGCTGATGCTGCCTCTAATGACTAATTTCCTTTTCAGAGATGGAAATAATTTACCAGGAAATGATTTCTTCATTTATCCATTGGGCATCAGAGCATATGAGCGAAGCAGCGTGTTGTGCCGTTCAGCTCTGTGCCACTGCGCTCCGCTCAATCGCTCATAGCCCAAGCCAATTCTCACACTCATGTCAAATTATTTTCTTTGTTATATCTCATTATCTCCGTAATAGCGTTTTACAATACATCTAAATTAAAGATAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29079
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087935 Essential Splice Site 971 1536 16 17
Genomic Location (Zv9):
Chromosome 18 (position 39474409)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 39760248
GRCz11 18 39740224
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTAGACCTGCCTCCAGGGGTGGAGCTTATCAGAGCCACACCATCAGCTGG[T/A]ATGATCATAAATATATACATGAGCAGCGAGCGATGGGAAGTTAATCATTT
Long Flanking Sequence:
AAGTCAATGACTACTGATAGGTATGGCAGTCAAAAATAAAATTTAAGGCAGAACAAATTTACTGGTAATTGTTGACCTCTGCTTGCATGCTCTGTTTAGCATCAGTAAATTACTGTGTATTATACTATGTCAGTATGTTTGTAAATTAGAATATCTGTGCTATTAGTTATCTCTTTCTTTCTCTGGATCTGAGGTATAACTAGTATATCATGCATGTTAGTGATTAGTGTCATTATTGATAACTGTTACATTTTGCTGATTCCTACAGAAGAACCCGTAAATGACTACATGTTCCAGAACCAGCTGACGGTTCCTTTGAGTCAGACCAATGCTGACTCATCTCCTGATATCACTCCGGGTCACAGTCCACTGCCACGCTCCTCCTCCTCCGCCAACTTGCAGTCAGCGAGCAAACTCATCCTGAGCTCTAAACTGGTCTACAGTCAGCGACTAGACCTGCCTCCAGGGGTGGAGCTTATCAGAGCCACACCATCAGCTGG[T/A]ATGATCATAAATATATACATGAGCAGCGAGCGATGGGAAGTTAATCATTTTACTGACTCGGACTTTTGAGTTTCGTTCATTGAGATGAACGAATAATTTTGTTCAATTTGACAAAATAATATTAAAATGTTATGAGTTCCTTCCAAACTAATCTGCAACTAGCCTAAACATTGATCAAACTACAAACAAGTCATAACTAGGATGCTATAAAAAAAGAGAGAATAATCATGTATTATTTACCTGGTCTTTTGTCTATGATTATGTCAGCTCACCTCTTTTGACAGGTTTTCAAATTTGAGTGGTTTATTCGTCACACTGACAGACCCCTATAAGCTTAACCAATGCACACAGTCTGAGCCTAAAGGAGCCATGATTAGTTCATCTTTCAAATCTTCTGGTTTTTGAGTCGTTCGTTCATCACGTGACAGCATGTAAAGAGAGATGACTGAAACCCGAGGACTCGAAAGATGTACAGATTAAATCTTTTTCTGGCTCTGAAT
Associated Phenotype:
Not determined