Busch Lab

ZMP

unc5db

Ensembl ID:
ENSDARG00000061541
ZFIN ID:
ZDB-GENE-060531-162
Description:
Novel unc-5 homolog family protein [Source:UniProtKB/TrEMBL;Acc:A3KPR8]
Human Orthologue:
UNC5CL
Human Description:
unc-5 homolog C (C. elegans)-like [Source:HGNC Symbol;Acc:21203]
Mouse Orthologue:
Unc5cl
Mouse Description:
unc-5 homolog C (C. elegans)-like Gene [Source:MGI Symbol;Acc:MGI:1923839]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa45203 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa25298 Nonsense Mutation detected in F1 DNA Not yet available
sa7566 Missense Mutation detected in F1 DNA Not yet available
sa31441 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa6978
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087857 Essential Splice Site 151 901 3 16
Genomic Location (Zv9):
Chromosome 5 (position 28950809)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 26706107
GRCz11 5 27306260
KASP Assay ID:
554-4586.1 (used for ordering genotyping assays)
KASP Sequence:
GCATGATTGTGCTGCATTGCCGTCCCCCAGAGGGAGTGCCCATGGCAAAG[G/A]TAAGACCCGTCCTCTCAGCCTCCAACACCATTTCCACAAAGAGATTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45203
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087857 Essential Splice Site 543 901 10 16
Genomic Location (Zv9):
Chromosome 5 (position 29003860)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 26759158
GRCz11 5 27359311
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGACACCTCTTGGGAAATGTACATGCTCATAAATCAAGGAGAGACTAGG[T/C]AAGACTGTACACTGACACAGCTGTTCTGTGTTCATATTTCTTGTTCAAGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5293
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087857 Nonsense 584 901 11 16
Genomic Location (Zv9):
Chromosome 5 (position 29020380)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 26775678
GRCz11 5 27375831
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTCCTGTCCTGTTGCCATGACGATAGCTCATTGTGCTGAAGTCAGCGCC[G/T]AAAACTGGAACATTAAACTCAAGAGACAAACCAAGGACAACAAGTGGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25298
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087857 Nonsense 692 901 13 16
Genomic Location (Zv9):
Chromosome 5 (position 29030009)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 26785307
GRCz11 5 27385460
KASP Assay ID:
554-7824.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACAGGGAGTGGTCACAGCTGAAACCTGCAGAGGAGGTCAGCTTTTAGAA[G/T]AGCCCAAGACACTGTTCTTCAAAGGAAACTGCCTCAGTCTGCAGGTGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7566
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087857 Missense 730 901 14 16
Genomic Location (Zv9):
Chromosome 5 (position 29033163)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 26788461
GRCz11 5 27388614
KASP Assay ID:
554-4064.1 (used for ordering genotyping assays)
KASP Sequence:
CAGCTCTCTGATTTCTCTCTCTCYCTTTTGTTCTGCTGCAGGAATTCTCC[T/C]TCACCCAAGTGTGGTATAGTAACCAGCAGCCTGTGCACTGTGCCTTCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31441
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087857 Nonsense 849 901 16 16
Genomic Location (Zv9):
Chromosome 5 (position 29042000)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 26797298
GRCz11 5 27397451
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAAAAATCTCCATTTCTGTCTGCACAGGAATCTGTCCTACTTCACCAAA[C/T]AGAAGAGTCCCTCTGCTGTCATTCTCAGTCTCTGGGAAGCCAGACATCAG
Associated Phenotype:
Not determined