Busch Lab

ZMP

b4galnt1a

Ensembl ID:
ENSDARG00000061520
ZFIN ID:
ZDB-GENE-070112-1462
Description:
beta-1,4 N-acetylgalactosaminyltransferase 1 [Source:RefSeq peptide;Acc:NP_001074039]
Human Orthologue:
B4GALNT1
Human Description:
beta-1,4-N-acetyl-galactosaminyl transferase 1 [Source:HGNC Symbol;Acc:4117]
Mouse Orthologue:
B4galnt1
Mouse Description:
beta-1,4-N-acetyl-galactosaminyl transferase 1 Gene [Source:MGI Symbol;Acc:MGI:1342057]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa25198 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19329
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087815 Nonsense 168 532 5 11
ENSDART00000142514 Nonsense 167 236 5 6
Genomic Location (Zv9):
Chromosome 23 (position 28355627)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28186194
GRCz11 23 28112735
KASP Assay ID:
554-6196.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGTAAAAGCACAAGATTACACATTAAGTCTGTTATTATGTTTTCAAGGTT[T/G]AAGTCTGAACCAAAAATCAGAAAAGGGCCCTTATTTGGTAAGCACAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25198
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087815 Essential Splice Site 461 532 11 11
ENSDART00000142514 None None 236 None 6
Genomic Location (Zv9):
Chromosome 23 (position 28340807)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28171374
GRCz11 23 28097915
KASP Assay ID:
554-7474.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATACTATACATGTGTATATATATAATGTATGTATTTTTATGTCTTCTTC[A/T]GGATTTTTTATTGACGGACTGGGCTCCCTCCACGTGGGCTCCTGTAATGA
Associated Phenotype:
Not determined