Busch Lab

ZMP

si:dkey-184d2.1

Ensembl ID:
ENSDARG00000061517
ZFIN ID:
ZDB-GENE-070912-401
Description:
Novel protein similar to vertebrate low density lipoprotein-related protein 1B (Deleted in tumors) (
Human Orthologue:
LRP1B
Human Description:
low density lipoprotein receptor-related protein 1B [Source:HGNC Symbol;Acc:6693]
Mouse Orthologue:
Lrp1b
Mouse Description:
low density lipoprotein-related protein 1B (deleted in tumors) Gene [Source:MGI Symbol;Acc:MGI:21511

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa41477 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa13908 Nonsense Available for shipment Available now
sa34700 Nonsense Available for shipment Available now
sa9125 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2533
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087800 None None 1186 None 27
ENSDART00000139033 Nonsense 2183 4456 39 87
Genomic Location (Zv9):
Chromosome 9 (position 37608181)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 36746077
GRCz11 9 36555872
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGGACACGATTTACTGGACCAGCTCCACCACCTCCAGCATCAGCAGATA[C/A]ACAGTAGACCAGAGCCGACAAGGAGCCTTCGGGAGGCAAGCTGTTGTCAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5554
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087800 None None 1186 None 27
ENSDART00000139033 Nonsense 2216 4456 39 87
Genomic Location (Zv9):
Chromosome 9 (position 37608278)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 36746174
GRCz11 9 36555969
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCACCATGTCTGAGGAYGACMATCCTCAYGTCYTGGCTCTAGATGAATGT[C/T]AAAAGTAAGTGACTGCTATTATCTGTAAAGAATATTCTTTAATTACAAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7201
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087800 None None 1186 None 27
ENSDART00000139033 Essential Splice Site 3209 4456 60 87
Genomic Location (Zv9):
Chromosome 9 (position 37665662)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 36803558
GRCz11 9 36613353
KASP Assay ID:
554-5404.1 (used for ordering genotyping assays)
KASP Sequence:
TTAGGATTGCTGTAGTTTATGCTTCCCATAACTGATTGGCATTTTTTGCA[G/A]TTCCGCTGTGGAACGGATGAGTGCATCCCATTCTGGTGGAAATGTGATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41477
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087800 None None 1186 None 27
ENSDART00000139033 Essential Splice Site 3240 4456 61 87
Genomic Location (Zv9):
Chromosome 9 (position 37670068)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 36807964
GRCz11 9 36617759
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAATTGCTTCGAATCCTCCGGAGTTCACTGTTAATCACCGTTTTTTTGC[A/T]GCGGAATTCAAATGCCAGCCTGGGCGATTTCAGTGTGGCACCGGCCTTTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27443
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087800 None None 1186 None 27
ENSDART00000139033 Essential Splice Site 3645 4456 70 87
Genomic Location (Zv9):
Chromosome 9 (position 37695404)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 36833300
GRCz11 9 36643095
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTGTGGGGACAACTCAGATGAAGATGAATGCGGTAGGCTCATTCACAA[G/A]TCCCTGATGATCCTGTTATCCTCACCGGCACTATGGGAAATCCATCTTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27444
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087800 Essential Splice Site 438 1186 11 27
ENSDART00000139033 Essential Splice Site 3771 4456 73 87
Genomic Location (Zv9):
Chromosome 9 (position 37700782)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 36838678
GRCz11 9 36648473
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACATGTGACAAAAATTATAAGGATATGAATGGTAGCTGCATAGCAAAAG[G/A]TAAGGATCTATATTTTCTATCGACTTAACCTTTGCCTTCACTGTGACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13908
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087800 Nonsense 556 1186 13 27
ENSDART00000139033 Nonsense 3889 4456 75 87
Genomic Location (Zv9):
Chromosome 9 (position 37705924)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 36843820
GRCz11 9 36653615
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CYGGACTGACCACTCTAGGATGCACTGGTTCAGTTATTACACAGCTCACT[G/A]GACCAAACTTAGATACTCTATTAATGTGGGGCAGCTCAAGGGACCCAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34700
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087800 Nonsense 725 1186 16 27
ENSDART00000139033 Nonsense 4058 4456 78 87
Genomic Location (Zv9):
Chromosome 9 (position 37712060)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 36849956
GRCz11 9 36659751
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGGGATTGAAAAAACGACGAATGTCCTGATCTCTCATCGTTTCAAACAG[C/T]AAGATGGTAGGATAATGTTTTCCATTTAGGCTTTTCCTCCTTTTTTTCTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2531
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087800 Nonsense 941 1186 21 27
ENSDART00000139033 Nonsense 4274 4456 83 87
ENSDART00000087800 Nonsense 941 1186 21 27
ENSDART00000139033 Nonsense 4274 4456 83 87
Genomic Location (Zv9):
Chromosome 9 (position 37728753)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 36866649
GRCz11 9 36676444
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATTTTTAGCTCATGCAATTTGTTCTCGTTCTGCCAGCTGTACCAGCGGT[C/T]GAATCGCCTCCAGCTGCCAGTTGTGTGATGGCTACTGCTATAACGGAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9125
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087800 Nonsense 941 1186 21 27
ENSDART00000139033 Nonsense 4274 4456 83 87
ENSDART00000087800 Nonsense 941 1186 21 27
ENSDART00000139033 Nonsense 4274 4456 83 87
Genomic Location (Zv9):
Chromosome 9 (position 37728753)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 36866649
GRCz11 9 36676444
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATTTTTAGCTCATGCAATTTGTTCTCGTTCTGCCAGCTGTACCAGCGGT[C/T]GAATCGCCTCCAGCTGCCAGTTGTGTGATGGCTACTGCTATAACGGAGGC
Associated Phenotype:
Not determined