Busch Lab

ZMP

zgc:153957

Ensembl ID:
ENSDARG00000061504
ZFIN ID:
ZDB-GENE-070209-38
Description:
hypothetical protein LOC570194 [Source:RefSeq peptide;Acc:NP_001077320]
Human Orthologue:
KDM4C
Human Description:
lysine (K)-specific demethylase 4C [Source:HGNC Symbol;Acc:17071]
Mouse Orthologue:
Kdm4c
Mouse Description:
lysine (K)-specific demethylase 4C Gene [Source:MGI Symbol;Acc:MGI:1924054]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa39604 Nonsense Mutation detected in F1 DNA Not yet available
sa19486 Nonsense Available for shipment Available now
sa12098 Nonsense Available for shipment Available now
sa24842 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39604
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087729 Nonsense 116 1482 4 22

The following transcripts of ENSDARG00000061504 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 20776277)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21248373
GRCz11 1 21941310
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGATGTGTGCTCTACCTCCTCAGGTACTGTACACCGCGCTATCTGAACTA[T/A]GAAGACCTGGAGAGGAAGTATTGGAAGAATCTGACATTCGTCTCGCCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19486
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087729 Nonsense 330 1482 9 22

The following transcripts of ENSDARG00000061504 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 20782191)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21254287
GRCz11 1 21947224
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATATGGTGAAGATCTCCATGGATCCATTTGTTAGACGATTTCAGCCGGAT[C/T]GATACGAGATGTGGACGCAAGGCAAAGATTCATGCTCCCTGGATCACACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12098
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087729 Nonsense 534 1482 11 22

The following transcripts of ENSDARG00000061504 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 20785128)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21257224
GRCz11 1 21950161
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGAYGTGACTYTAGGCTCAGAAAGAACTGCTRAGAATCCTAATCAAACAT[T/A]AAACTGTGAATCTGTCTYAGAAAYCATTGCACCTTCTATTCCTGTGACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24842
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087729 Nonsense 866 1482 11 22

The following transcripts of ENSDARG00000061504 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 20786123)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21258219
GRCz11 1 21951156
KASP Assay ID:
554-7764.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGCCCATGATTCGTTACCGTACACCATGTGGTCAGAGTCAGGGTGCCAA[C/T]AAGAAAAGTTCTCAGATTCTCCAAACTCTTCACCTCACACCCAGACCTGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1889
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087729 Splice Site, Nonsense 1398 1482 20 22

The following transcripts of ENSDARG00000061504 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 20803811)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21275907
GRCz11 1 21968844
KASP Assay ID:
554-1879.1 (used for ordering genotyping assays)
KASP Sequence:
GACTTTTATATGGAGCCAAATATCTTGGCTCGAACACTTCATATATGTAT[C/T]AGGTACATTCTCTAACAGTCACATCAAGTACTGCTGCTCTGCTATTACTT
Associated Phenotype:
Not determined