Busch Lab

ZMP

THSD7B (2 of 2)

Ensembl ID:
ENSDARG00000061497
Description:
thrombospondin, type I, domain containing 7B [Source:HGNC Symbol;Acc:29348]
Human Orthologue:
THSD7B
Human Description:
thrombospondin, type I, domain containing 7B [Source:HGNC Symbol;Acc:29348]
Mouse Orthologue:
Thsd7b
Mouse Description:
thrombospondin, type I, domain containing 7B Gene [Source:MGI Symbol;Acc:MGI:2443925]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa21942 Nonsense Available for shipment Available now
sa35123 Nonsense Mutation detected in F1 DNA Not yet available
sa41879 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa31841 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21942
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087690 Nonsense 209 1573 1 29
Genomic Location (Zv9):
Chromosome 11 (position 34513855)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 33414792
GRCz11 11 33677594
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAAAGGGGTGGCACCTGTTGGGAAAACAACAGTGGATTTTAATTTGGGG[A/T]AAAGTACAGTCAGGACTTCCTATACAATAAAGCGGCACGCGGAAGGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35123
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087690 Nonsense 473 1573 6 29
Genomic Location (Zv9):
Chromosome 11 (position 34535199)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 33436136
GRCz11 11 33698938
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCATTCGCAGGTTTCAAGATTAGAAGTCGTTCTGTAATTACGGAGTCTTG[G/A]GTCGAGTCTGACAGTTGCCCTCACGTCAGCGAAGCAATGACCTGCGATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41879
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087690 Essential Splice Site 671 1573 8 29
Genomic Location (Zv9):
Chromosome 11 (position 34561292)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 33462229
GRCz11 11 33725031
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCAAGTCATATGCAGGAGGGCTGGGAATGGACATGTGCTGCCAAAACGG[T/C]AAAGAAGCACAAAAATCTTACAGACTAACTCTTGTTCAGGCTTCTATGAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa827
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087690 Nonsense 819 1573 12 29
Genomic Location (Zv9):
Chromosome 11 (position 34576188)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 33477125
GRCz11 11 33739927
KASP Assay ID:
554-0731.1 (used for ordering genotyping assays)
KASP Sequence:
GCCGAGTGTGTGAGCTGGGCAGGACTGATGCCCGTGTCAGTGAGGGAGTG[T/A]CGTGTGCCATGCAGAGATGAATGCAGCTTCACCTCCTGGAGCAGATTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31841
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087690 Essential Splice Site 896 1573 14 29
Genomic Location (Zv9):
Chromosome 11 (position 34576738)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 33477675
GRCz11 11 33740477
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCAGCAGTGAAGAGCACTGCTGGACGGCCTTTCATCCAAGGAGTTTTCC[A/G]CCAAGGCCAGAAGGCAGTCCAGGACTGGCGAGGCCTTAGGAGGAGCAGCG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27811
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087690 Essential Splice Site 896 1573 14 29
Genomic Location (Zv9):
Chromosome 11 (position 34576739)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 33477676
GRCz11 11 33740478
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGCAGTGAAGAGCACTGCTGGACGGCCTTTCATCCAAGGAGTTTTCCA[C/A]CAAGGCCAGAAGGCAGTCCAGGACTGGCGAGGCCTTAGGAGGAGCAGCGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4426
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087690 Nonsense 1190 1573 20 29
Genomic Location (Zv9):
Chromosome 11 (position 34591173)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 33492110
GRCz11 11 33754912
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCCTGAACTGYRTGCGCAGTGATGGGAAACTGGTGGAGCTCAGCCTGTGC[A/T]AAGAGGTGACTGTGCWTTTCTCAGTGGAATCCCCWGTAGGAATGCAGATG
Associated Phenotype:
Not determined