Busch Lab

ZMP

si:dkey-79l8.1

Ensembl ID:
ENSDARG00000061493
ZFIN IDs:
ZDB-GENE-080220-5, ZDB-GENE-090311-32
Description:
potassium voltage-gated channel subfamily G member 1 [Source:RefSeq peptide;Acc:NP_001103880]
Human Orthologue:
KCNG1
Human Description:
potassium voltage-gated channel, subfamily G, member 1 [Source:HGNC Symbol;Acc:6248]
Mouse Orthologue:
Kcng1
Mouse Description:
potassium voltage-gated channel, subfamily G, member 1 Gene [Source:MGI Symbol;Acc:MGI:3616086]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa14567 Nonsense Available for shipment Available now
sa24395 Nonsense Available for shipment Available now
sa32465 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14567
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101344 Nonsense 13 521 2 5
ENSDART00000141240 None None 225 None 1
Genomic Location (Zv9):
Chromosome 23 (position 39432974)
Other Location(s):
Assembly Chromosome Position
GRCz11 23 39321632
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGAGCTGAAAGATGACTTTACTGGCAGGCGATGGTTCGGATTATGACTA[C/A]AGCGCACTGAGCTGCACCTCTGACACCTCTCTRAACGCTCCACCCRTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24395
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101344 Nonsense 282 521 3 5
ENSDART00000141240 None None 225 None 1
Genomic Location (Zv9):
Chromosome 23 (position 39476560)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 39438261
GRCz11 23 39331172
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCTCAGATGTGCTACAACATCTTCATCGTGGAGACGGTGTGCGTGGCCT[G/A]GTTCTCGCTGGAGTTCACTCTGCGCTTCATCCAGGATCGCAGCAAGCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32465
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101344 Nonsense 420 521 4 5
ENSDART00000141240 Nonsense 124 225 1 1
Genomic Location (Zv9):
Chromosome 23 (position 39477110)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 39438675
GRCz11 23 39331586
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAACGAAGCCGCAGCCACGAGGGAGTTCAGTAGCATCCCTGCCACATACT[G/A]GTGGGCTGTTATTACAATGACCACGGTTGGATATGGAGATATGGTGCCGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1157
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101344 Nonsense 478 521 4 5
ENSDART00000141240 Nonsense 182 225 1 1
Genomic Location (Zv9):
Chromosome 23 (position 39477283)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 39438848
GRCz11 23 39331759
KASP Assay ID:
554-1068.1 (used for ordering genotyping assays)
KASP Sequence:
CCTCCATCTTCCACACTTTTTCCCGCTCCTACGTAGAGCTCAAGCAGGAA[C/T]AACAGCGGCTGCTCCAGCGCAGGACTCACTTCCTACTGCGCAGCCGCATC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461