Busch Lab

ZMP

si:dkeyp-86b9.1

Ensembl ID:
ENSDARG00000061486
ZFIN ID:
ZDB-GENE-060531-163
Description:
Novel protein similar to vertebrate dynein, cytoplasmic, heavy polypeptide 1 (DNCH1) [Source:UniProt
Human Orthologue:
DNAH10
Human Description:
dynein, axonemal, heavy chain 10 [Source:HGNC Symbol;Acc:2941]
Mouse Orthologue:
Dnahc10
Mouse Description:
dynein, axonemal, heavy chain 10 Gene [Source:MGI Symbol;Acc:MGI:1860299]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa20435 Nonsense Available for shipment Available now
sa6980 Nonsense Mutation detected in F1 DNA Not yet available
sa20436 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20435
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087708 Nonsense 571 3330 10 58
ENSDART00000135878 Nonsense 1597 4262 24 70
Genomic Location (Zv9):
Chromosome 5 (position 29978050)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 27733348
GRCz11 5 28333501
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAATGAAGGAGAGAAGCAGGCACTGAAGCAGTATGCAAAGAAAATGCAC[C/T]AGCAGATCAATGACCTGGTGAAACGCATCACAGAACCCTTAAAGAAGAAT
Long Flanking Sequence:
ATTGACAGATGTATGACAACATAGCAGCTTTGCGTTTCGATACGGGAATGAATGGAGAGATGGTGGCAAATGCACTTGTGTCTGCTGAGGGGGAGGTGATGGAGCTCAAACAGCCTGTACCTGCAGAGGGCCGCGTGGAGGACTGGATGACTGCGGTGCTGTTGGAGATGAGAAGAACCAACAGACTCATCACCAAAGAGGCTATTTACTTCTACAGCCACCAAAAGTCAAGGTAAGTCCAATATTAAATGCCATGCTACACAATCATGACCCAGCACTATCAATCTAAGCTGATCGCTTGCCTTTCTGATTATAATTTGCAAGAAGTTTATAAAATGGTCTTCTGCTGTTCTGTCAGAGTGGACTGGATGCTTGACTACCAGGGTATGGTGGTACTAGCAACAAACCAGGTATGGTGGACCTATGAGGTGGAAGATGTCTTCAGGAGGATGAATGAAGGAGAGAAGCAGGCACTGAAGCAGTATGCAAAGAAAATGCAC[C/T]AGCAGATCAATGACCTGGTGAAACGCATCACAGAACCCTTAAAGAAGAATGACAGACGAAAAATCAACACTGTCCTCATCATTGATGTCCATGCTAGAGATATTGTGGACTCTTTTGTCAGAGACAGGTACGATACAAACAACGTGCAGTCATTTACTGTGTTACACAGTAAATCAAAAATGGAGGAAAACTATACTCTAAAGTGAAAATTCTATTTTTTTTTACCTTGTGTGATCCAAAATGTACATGACTTTGTTCAGATGAACATAAGTCTCTTCAAGGCAAGTCATTTTACTCGGCAGCCATCTTTGAAACGCCTCTCGGCCAGTATGCTTGGGCATTCTGTTTGAATGGAAAACATCAAATTCTCCAAAAGTACTTGCCAAGCTTGTGATTACATTTCGTATTACGAATAGCCAGCAAAATTAAACAACAACTGTCTATTTAGTTTCATTTCTAAATGTTCATATCACACAAAATCTGCAGAGACTCACGTCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6980
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087708 Nonsense 1437 3330 26 58
ENSDART00000135878 Nonsense 2376 4262 38 70
Genomic Location (Zv9):
Chromosome 5 (position 29993908)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 27749206
GRCz11 5 28349359
KASP Assay ID:
554-5010.1 (used for ordering genotyping assays)
KASP Sequence:
TCATTGCAGCCATGGGGAAGGCAGGYGGTGGTAGGAATGAAGTGGACCCA[C/T]GATTCATMTCTCTTTTCAGTGTGTTCAACATCCCCTTCCCTGAGGAGGAA
Long Flanking Sequence:
TGCCTTAATTAACAGCATCATTATAAGTAAAATATAATAAACTACAATAATGAATATAATATAACAAATTAGTATAATAAGTCTCACCTTTTCCCAGATAATGATGACCATCAATTTCTCATCAAGAACAACCTCTATGGACCTGCAGAGGACTCTGGAGGCAAATGTTGAAAAGAGAACCAAGGACACGTTTGGTCCTCCTATGGGCAAAAGGCTCCTTGTCTTTATGGATGACCTCAACATGCCAAGGGTAACACTGTGTTTATACTGTACATCATCTCTCAAATCAGTTTTACAACACTGCTCATAATGGATTCACATTTGTTTGTTCTCAGGTGGATGAATATGGAACTCAACAACCTATAGCTCTCCTCAAGCTTCTGTTGGACAGGGGTGGCATGTATGACCGAGGAAAAGAACTCAACTATAAACTCATAAAGGACCTGGGCTTCATTGCAGCCATGGGGAAGGCAGGCGGTGGTAGGAATGAAGTGGACCCA[C/T]GATTCATCTCTCTTTTCAGTGTGTTCAACATCCCCTTCCCTGAGGAGGAATCCCTACATCTCATCTACTCTTCTATTCTAAGAGGACACACCAAGGTGCAAGAGATATTTCAGCTTCTTGATTAAAAAATGATGGGATGTGCTGACATGAAGTCAAATATTAAATATAGGTGTCTATTGTAGGGCTGCACTGATGGAATGAGATATTTCTTCATTGCAATTATTTTCTCATGTTGTGTTTATAATTTAGATTTTCGTATAAATATTTATCTTGATTCTATTTTATGATTTTTAAATCAGAATTATGTCTATTTTATTTTATAGCCCTTTGAGGAGTGCATCCGAAACATCTGTGACAAGCTGACGTTTTGCACTCTGGAGCTGTACAAAACCATAATTAAGGATTTACCGCCAACACCTTCCAAGTTCCACTACATCTTTAACCTGAGAGATCTCTCCAGAGTCTACCATGGCCTGACGCTGACCAACCCTGAGAGGTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26484
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087708 Essential Splice Site 1526 3330 27 58
ENSDART00000135878 Essential Splice Site 2465 4262 39 70
Genomic Location (Zv9):
Chromosome 5 (position 29994405)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 27749703
GRCz11 5 28349856
KASP Assay ID:
2259-5892.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAGATCTCTCCAGAGTCTACCATGGCCTGACGCTGACCAACCCTGAGAG[G/A]TTTGCAGTTTCATCATTAAGATTTAGAAAGGGCTAATACCCTTATGTTTA
Long Flanking Sequence:
CCACGATTCATCTCTCTTTTCAGTGTGTTCAACATCCCCTTCCCTGAGGAGGAATCCCTACATCTCATCTACTCTTCTATTCTAAGAGGACACACCAAGGTGCAAGAGATATTTCAGCTTCTTGATTAAAAAATGATGGGATGTGCTGACATGAAGTCAAATATTAAATATAGGTGTCTATTGTAGGGCTGCACTGATGGAATGAGATATTTCTTCATTGCAATTATTTTCTCATGTTGTGTTTATAATTTAGATTTTCGTATAAATATTTATCTTGATTCTATTTTATGATTTTTAAATCAGAATTATGTCTATTTTATTTTATAGCCCTTTGAGGAGTGCATCCGAAACATCTGTGACAAGCTGACGTTTTGCACTCTGGAGCTGTACAAAACCATAATTAAGGATTTACCGCCAACACCTTCCAAGTTCCACTACATCTTTAACCTGAGAGATCTCTCCAGAGTCTACCATGGCCTGACGCTGACCAACCCTGAGAG[G/A]TTTGCAGTTTCATCATTAAGATTTAGAAAGGGCTAATACCCTTATGTTTAATATGATGTGTACAAAGGGGATTCCAATGGGGTTTTCAAAGGCATAGTTGAACCTAAATTTCTGTCAACATTTTTTTAAATCATACAATTCTATATAACATTGACTCTTGTTCACCTTCAGAACATAAATGAAGATAATTGTAATGAAGAGTGACAGATCTGACAGAAGTCTATCTCTCCTTTGACAGTCTGTTCACCTTTGGTTAGACTTATAGATTATTATTATTTTATTTCTTCGGGATGTTTTAAAGGGGACCTATTATTTAAAACTGTGACAAACCCAAACATTTTTTTAACTCTTTGAAACTGACCCCTTAATGTTTTTTTTAATTATGCCATTTTGGTGACTGTCGCTTTAAATTGAAACTATTCAATTCAAAAGATTGTGCTAATGAGTGTGTATGGATGTTTCCTAGTACTGGGTTGCAGCTGGAAGGGCATCCATTATGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5294
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087708 Nonsense 1669 3330 30 58
ENSDART00000135878 Nonsense 2601 4262 42 70
Genomic Location (Zv9):
Chromosome 5 (position 29997328)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 27752626
GRCz11 5 28352779
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAATGGATCGAGGTCATGCATTGCTGGTTGGTGTAGGTGGTTCAGGGAAA[C/T]AGTCTCTTACAAAGCTGGCTGCCTTCACTGCAGGTTATGAGGTATGAAGG
Long Flanking Sequence:
TCAATGAAACTGACAAAATCATGGTATGCTTGCTTCCTGTAAACCTAGGGCTCTTAATAATGTTACTATGGACTAGGTATTGTCTTCTCGATTAACACTCAGGTCCAAGGACATGTAAAGAATCTGGTTGAAGAACACTTCAAATCAGACCTGGATTCAGCCATGAGAGATCCAATTCTGTTTGGCGATTATAGAACAGCTCTTAAATCTGAGCCAAGGGTTTATGAGGATATACTGGACTATGATGCATCCAAAGCTCTGTTTCAGGTGCATGGGGGTCTTATTTGCTCCACTTACTGTATATTTACATTATGGCACATTAATGCCATCTGTTCTTCCTCTGACTCATGTAGGAAATCCTGGAGGAGTATAATGAAAATAAGACAAAAATGAACTTAGTGCTGTTCGATGATGCACTTGAACACCTGACTGTCATTCATCGCATTATTAGAATGGATCGAGGTCATGCATTGCTGGTTGGTGTAGGTGGTTCAGGGAAA[C/T]AGTCTCTTACAAAGCTGGCTGCCTTCACTGCAGGTTATGAGGTATGAAGGTTATGTTTCTCAATGCATATTTTGCATGTATGTCATAATTCATCTTACATTTGATATATTTTATCTGACCTGGTTTGATGTTAATCTTTAGCTCTTTGTCTAAAGGTGTTTGAAATTGTGCTTAGTAGAGGATACTCAGAGACTAACTTTCGGGATGATCTGAAAACTCTGTACCTCAAACTGGGTATAGAGAATAAGAAAATGGTTTTCCTGTTCACTGATGCTCATGTGGCCGAGGAAGGTTTTCTGGAGCTCATCAACAACATGCTTACATCAGGTATTTGAAATGACTGTTCATGAAAATAACACATGTGTAAATCAATTGGTTTAATTTAAATTAGGTCTGCTTCTTTGGACTGGACTGTATCTAAAGGTGCCATAGAATGAAAATCTGGAAATACACTCACCGGCCACTTTATTAGGTCCAACTGCTTGTTAACGCAAATTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20436
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087708 Nonsense 3187 3330 56 58
ENSDART00000135878 Nonsense 4119 4262 68 70
Genomic Location (Zv9):
Chromosome 5 (position 30021643)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 27776941
GRCz11 5 28377094
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTGGTGCAGGTGAATGAAGGAGAGCCGTACGTGATGTGGCTCTCAGGTT[T/A]GCATATCCCTGAATCGTACCTGACTGCGTTGGTCCAGGCCACGTGCAGGA
Long Flanking Sequence:
GCTGTTACAAGGTATTAAATTTTGCATCATTTTTGATTATACAGTTATATAACGTTATTATAGTTGTTAACTAAAGTTAGAAATTTTGGGATGCTATGTAGTTTATGAAATTGATAGAATCCTGCCATACTTGATGTCGCACTGCTCTGTTTACTACAGTAACGAAGGCAGCACCATTATTTTTGCTGTTCTATAGGCGACACCTTATGGATTAACATTTTTATAAAGTATATGAGTATTGTTTCAGTTTAGGATTAGTTTCTTACAATCCATATTTAGGGAATATATTTAAAATGTCACTAATGTTACTGGTTCAGTAGTGATAATGTCTTAAAATGTATGAAAAGAGTGTAAAAAATGTCTTAAAAGGTTTTAAATTTTACTCTCTGATTCCTGTATATACCCTGTTTTAAATGTAATGAATGGCCTACTAAATAAATGCCTTTTTTCATTGGTGCAGGTGAATGAAGGAGAGCCGTACGTGATGTGGCTCTCAGGTT[T/A]GCATATCCCTGAATCGTACCTGACTGCGTTGGTCCAGGCCACGTGCAGGAAGAACGGCTGGCCTCTGGATCACTCTACTCTCTACACACAGGTCACACAATACAGCAGCGAGGACCAGGTCAAAGAGAGACCAGGACAAGGTGAGGGCATGTGCACTAAATGAACACAAAGATACTGTGAGTCAAGAACAGACTGAAAACACGCTCTTTCCGTTTTTGTCTCTCAGGATGTTTTGTATCAGGACTGTATCTGGAGGGTGCAGACTGGGACATTGACAACGGGTGTTTGGTGCGCAGCAAACCAAGAGTCCTGGTGTCTCAGCTACCCATCCTCAAAATCATCCCTATTGAAGCACGTCGCCTCAAACTACAGGCAAGACTTTCCTTATTAAAAACAAGAAACTACTGGCACCTCTGAGTTTAAATTGATATTTTGACCTTTACGGATTTTCTATTTTTTCCATTTATTTTTTTCATTCTAATGGAAAGAAAACATCCAAA
Associated Phenotype:
Not determined