Busch Lab

ZMP

si:ch211-132b12.1

Ensembl ID:
ENSDARG00000061480
ZFIN ID:
ZDB-GENE-050420-315
Description:
hypothetical protein LOC100034467 [Source:RefSeq peptide;Acc:NP_001076533]
Human Orthologues:
SLC6A11, SLC6A12, SLC6A13
Human Descriptions:
solute carrier family 6 (neurotransmitter transporter, GABA), member 11 [Source:HGNC Symbol;Acc:1104
solute carrier family 6 (neurotransmitter transporter, GABA), member 13 [Source:HGNC Symbol;Acc:1104
solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12 [Source:HGNC Symbol;
Mouse Orthologues:
Slc6a11, Slc6a12, Slc6a13
Mouse Descriptions:
solute carrier family 6 (neurotransmitter transporter, GABA), member 11 Gene [Source:MGI Symbol;Acc:
solute carrier family 6 (neurotransmitter transporter, GABA), member 13 Gene [Source:MGI Symbol;Acc:
solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12 Gene [Source:MGI Sym

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa16967 Nonsense Available for shipment Available now
sa15976 Nonsense Available for shipment Available now
sa13216 Essential Splice Site Available for shipment Available now
sa2964 Essential Splice Site F2 line generated Not yet available
sa1085 Nonsense F2 line generated Not yet available
sa986 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16967
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087699 Nonsense 77 586 2 14
Genomic Location (Zv9):
Chromosome 18 (position 38850048)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 40562765
GRCz11 18 40552957
KASP Assay ID:
2261-2496.1 (used for ordering genotyping assays)
KASP Sequence:
GTGGGGTGCCTCTGTTTTTGCTGGAGATGGCTATGGGACAGTACACTCAG[C/T]AAGGGGGTGYWACGTGCTGGCATCGCCTCTGTCCACTTGCTGAGGGTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15976
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087699 Nonsense 240 586 6 14
Genomic Location (Zv9):
Chromosome 18 (position 38852187)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 40564904
GRCz11 18 40555096
KASP Assay ID:
2261-2498.1 (used for ordering genotyping assays)
KASP Sequence:
TGATGCTGCTTGTGTTGYTGATYCRTGGRWTGACTCTTCCTGGAGCTCTK[C/T]AGGGGGTTGTGTTTTATCTGTACCCTGAACCGRCCCGTCTTGCTGWTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13216
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087699 Essential Splice Site 257 586 6 14
Genomic Location (Zv9):
Chromosome 18 (position 38852242)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 40564959
GRCz11 18 40555151
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGTTGTGTTTTATCTGTACCCTGAACCGGCCCGTCTTGCTGWTCCACAGG[T/A]AACTCCACATAACAAGACACTGACWGTGTCATATTTTAWTGTWCTAATAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa835
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087699 Nonsense 323 586 8 14
Genomic Location (Zv9):
Chromosome 18 (position 38855747)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 40568464
GRCz11 18 40558656
KASP Assay ID:
554-0738.1 (used for ordering genotyping assays)
KASP Sequence:
TTGTGGCTGGTTTTGCTGTGTTCACAGTCTTGGGCTTCATGGCCCAGGAA[C/T]AGGGTGTCCCCATTGAAGAGGTAGCAGAGTCAGGTACTSCARCATTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2964
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087699 Essential Splice Site 371 586 9 14
Genomic Location (Zv9):
Chromosome 18 (position 38855982)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 40568699
GRCz11 18 40558891
KASP Assay ID:
554-2951.1 (used for ordering genotyping assays)
KASP Sequence:
GGCTGTTTGTTTCTTCATCATGATTATTTTRCTAGGCCTAGATACACAGG[T/C]AATTTTAAACTAACACATGTACAACAAAACAATAGATATATTTACAATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1085
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087699 Nonsense 407 586 10 14
Genomic Location (Zv9):
Chromosome 18 (position 38858050)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 40570767
GRCz11 18 40560959
KASP Assay ID:
554-0987.1 (used for ordering genotyping assays)
KASP Sequence:
CGCAGAGAAGGACGGCGAGAAATCTTACTCCTGTTCTTTTGTCTCACTTG[C/A]TTCTTTGGCCAATTCATCATGGTTACAGAGGTTAGAAGCGTGCGTGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa986
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087699 Nonsense 532 586 13 14
Genomic Location (Zv9):
Chromosome 18 (position 38859333)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 40572050
GRCz11 18 40562242
KASP Assay ID:
554-0890.1 (used for ordering genotyping assays)
KASP Sequence:
GGTTACTGGCTCTGTCMTCCATTGTGCTTGTGCCTGGATGGGCACTGGGC[C/T]GACTGTGCWCTGAAAAGGGGAGTTTAAAACAGGTTAGGATGTTTATCTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29076
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087699 Nonsense 560 586 14 14
Genomic Location (Zv9):
Chromosome 18 (position 38862628)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 40575345
GRCz11 18 40565537
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGGCGCCGTTTGTGCAGTGCTGATAAAGACCTTCCACTCACCTGTAAA[C/T]AACGAGCTCAATTAAAGGAAACGGCTTTCATGACAGAAATGGAAGACTTA
Associated Phenotype:
Not determined