Busch Lab

ZMP

sema5b

Ensembl ID:
ENSDARG00000061471
ZFIN ID:
ZDB-GENE-070912-187
Description:
Novel protein similar to vertebrate sema domain, seven thrombospondin repeats (Type 1 and type 1-lik
Human Orthologue:
SEMA5B
Human Description:
sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and sh
Mouse Orthologue:
Sema5b
Mouse Description:
sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and sh

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa25431 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa14533 Nonsense Available for shipment Available now
sa21542 Nonsense Available for shipment Available now
sa34702 Nonsense Mutation detected in F1 DNA Not yet available
sa13826 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25431
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087663 Essential Splice Site 133 1101 4 21
ENSDART00000138345 Essential Splice Site 70 1038 3 20
Genomic Location (Zv9):
Chromosome 9 (position 38626150)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 37764046
GRCz11 9 37573841
KASP Assay ID:
554-7644.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCCAGACGAAGACACCAGGAGGTCCTGTCAAAGCAAAGGGAAGACGGAG[G/A]TAACTTTAAACCCCCAGGTTCTCTGTTGAATAGGCACATTTCTTTCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14533
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087663 Nonsense 174 1101 6 21
ENSDART00000138345 Nonsense 111 1038 5 20
Genomic Location (Zv9):
Chromosome 9 (position 38622804)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 37760700
GRCz11 9 37570495
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTGATTCATACCGCATCCTYCTCTCAGGCAGGGAACATGAGCAGAGTGT[T/A]GGAGAGGGTGAACGGAGTGGCCCGCTGTCCCTATGACCCCCGTCATAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21542
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087663 Nonsense 202 1101 6 21
ENSDART00000138345 Nonsense 139 1038 5 20
Genomic Location (Zv9):
Chromosome 9 (position 38622719)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 37760615
GRCz11 9 37570410
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACCCCCGTCATAACTCCACAGCGGTGGTGACTGAAAGTGGAGAGCTGTA[C/A]GCTGCCACGGTCATCGATTTCTCTGGACGGGACCCTGTCATCTACCGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34702
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087663 Nonsense 513 1101 10 21
ENSDART00000138345 Nonsense 450 1038 9 20
Genomic Location (Zv9):
Chromosome 9 (position 38599275)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 37737171
GRCz11 9 37546966
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCCTGAATGACAAAGTGCTCAAGATCCCTCTAGCGAGATGCTCCAGCTA[C/A]AAAACTGAGTTGTGAGTCCCATGTTTTAATTTGTTCTCAAACAGCTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13826
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087663 Nonsense 703 1101 14 21
ENSDART00000138345 Nonsense 640 1038 13 20
Genomic Location (Zv9):
Chromosome 9 (position 38569341)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 37707237
GRCz11 9 37517032
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGTGCAGTGCAGATTGTGGTGGAGGTGTGCACTCTCGCTCCAGGAACTG[T/A]GAGAATGGAAATAGCTGTCCAGGSTGTGCGCTGGTACGTATACCTGAAGC
Associated Phenotype:
Not determined